Padronização da metodologia do RT-PCR utilizado para identificação do mRNA da alfa-amilase em sementes de milho
Carregando...
Data
2002-01-01
Autores
Dantas, Bárbara França
Aragão, Carlos Alberto
Araújo-Junior, João Pessoa [UNESP]
Rodrigues, João Domingos [UNESP]
Cavariani, Cláudio [UNESP]
Nakagawa, João [UNESP]
Título da Revista
ISSN da Revista
Título de Volume
Editor
Associação Brasileira de Tecnologia de Sementes (ABRATES)
Resumo
Durante a germinação das sementes, os carboidratos de reserva são degradados pela atividade de a-amilase. A identificação de mRNA é uma ferramenta fundamental para a definição da cinética de síntese de alfa-amilase. Objetivou-se padronizar a metodologia do RT-PCR para identificar o mRNA do gene de a-amilase em sementes de milho. Após três dias de germinação das cultivares Saracura-BRS 4154 e CATI-AL34, extraiu-se o RNA total pelo método do tiocianato de guanidina-fenol-clorofórmio, com algumas modificações. A partir do RNA total extraído foi obtido cDNA com utilização de random primers. A amplificação por PCR de uma porção do gene da alfa-amilase foi realizada com os primers: sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC; gelatina; DMSO e 1,25 unidades de Taq DNA polimerase por reação e completados com água tratada com DEPC. Os ciclos para a amplificação foram 94ºC durante 4 minutos, seguidos por 34 ciclos de 94ºC durante 1 minuto, 42ºC durante 1 minuto e 72ºC durante 1,5 minutos e, finalmente, 72ºC por 5 minutos. O produto do RT-PCR apresentou uma banda de 249 pares de base (pb) bem definida, para as duas cultivares estudadas, não ocorrendo bandas inespecíficas. A técnica do RT-PCR mostrou ser uma metodologia eficiente para a identificação da expressão de alfa-amilase durante a germinação das sementes e pode ser usado para estudo qualitativo e quantitativo da cinética de síntese dessa enzima em experimentos de germinação.
During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.
During germination the seed reserve carbohydrates are degraded by alpha-amylase activity. The identification of mRNA is a very important tool for definition of alpha-amylase synthesis kinetics. This study aimed to adapt a PT-PCR methodology for a-identification of amylase mRNA in germinating maize seeds. After three days germination of Saracura BRS4154 and CATI AL34 maize cultivars, the total RNA was isolated by the guanidinium thiocyanate-phenol-chloroform extraction method, with some modifications. The cDNA was obtained from the total RNA, using random primers. The alpha-amylase gene PCR amplification was carried out with cDNA, primers (sense - CGACATCGACCACCTCAAC; antisense - TTGACCAGCTCCTGCCTGTC); gelatina; DMSO and 1,25 units of Taq DNA polimerase per reaction and complete with DEPC water. The amplification cycles were 94ºC/4 minutes, 34 cycles of 94ºC /1 minute, 42ºC/1 minute and 72ºC/1,5 minutes, and finally 72ºC/5 minutes. The RT-PCR product visualization in agarose gel eletcrophoresis indicated that this method presented well defined bands of 249 bp for the both the cultivars, without unspecific bands. The RT-PCR is an eficient method for alpha-amylase expression studies during germination and can be used as a tool for quantitative and qualitative research about alpha-amylase sinthesis kinetics.
Descrição
Palavras-chave
Zea mays, sementes, alfa-amilase, RT-PCR, seeds, Zea mays, alpha-amylase, RT-PCR
Como citar
Revista Brasileira de Sementes. Associação Brasileira de Tecnologia de Sementes, v. 24, n. 2, p. 113-117, 2002.