Safety of Lactobacillus plantarum ST8Sh and Its Bacteriocin Svetoslav Dimitrov Todorov1 & Luana M. Perin1 & Bruno M. Carneiro2,3 & Paula Rahal2 & Wilhelm Holzapfel4 & Luís Augusto Nero1 Published online: 23 February 2017 # Springer Science+Business Media New York 2017 Abstract Total DNA extracted from Lb. plantarum ST8Sh was screened for the presence of more than 50 genes related to production of biogenic amines (histidine decarboxylase, tyrosine decarboxylase, and ornithine decarboxylase), viru- lence factors (sex pheromones, gelatinase, cytolysin, hyal- uronidase, aggregation substance, enterococcal surface pro- tein, endocarditis antigen, adhesion of collagen, integration factors), and antibiotic resistance (vancomycin, tetracycline, erythromycin, gentamicin, chloramphenicol, bacitracin). Lb. plantarum ST8Sh showed a low presence of virulence genes. Only 13 genes were detected (related to sex pheromones, ag- gregation substance, adhesion of collagen, tetracycline, gen- tamicin, chloramphenicol, erythromycin, but not to vancomy- cin, and bacitracin) and may be considered as indication of safety for application in fermented food products. In addition, interaction between Lb. plantarum ST8Sh and drugs from different groups were determined in order to establish possible application of the strain in combination with commercial drugs. Cytotoxicity of the semi-purified bacteriocins produced by Lb. plantarum ST8Sh was depended on applied concentra- tion—highly cytotoxic when applied at 25 μg/mL and no cytotoxicity at 5 μg/mL. Keywords Lactobacillus plantarum . Probiotics . Bacteriocins . Safety . Virulence . Cytotoxicity Introduction Research on lactic acid bacteria (LAB) with probiotic poten- tial is focused on different areas, including re-establishing of the gastrointestinal (GIT) microbiota, prevention and treat- ment of GIT disorders, stimulation of the immune system, treatment of skin diseases, prevention of some types of cancer, treatment of Helicobacter pylori, and involvement in oral health [1]. Parallel to a high number of reports dedicated to the study of beneficial properties of probiotic LAB, a limited number of studies focus on the safety aspects of these strains. Several Lactobacillus spp. have been granted GRAS status and are considered as safe for human and other animal appli- cations. Different Lactobacillus spp. are associated with the traditional production of different fermented food products from plant, meat, and dairy origin. However, some clinical cases were described and linked to some strains of Lactobacillus spp. typical of various fermented foods [2–4]. With the better understanding of the microbial interactions, including horizontal gene transfer and the genetic basis of potential virulence, it is necessary to re-evaluate the perspec- tive related to the safety issues of Lactobacillus spp. From traditional point of application, some strains can be considered as safe to be used as starter and beneficial cultures; however, they need to be carefully examined for the potential presence of virulence factors, and to take into account that most prob- ably these strains will be present in high viable cell numbers when applied as probiotics/beneficial cultures. Considering all this, safety aspects of the probiotic LAB need to be carefully examined on a strain by strain basis, and the risk of delivering virulence factors to the host should be excluded. * Svetoslav Dimitrov Todorov slavi310570@abv.bg 1 Veterinary Department, Universidade Federal de Viçosa, Campus UFV, Viçosa, Minas Gerais 36570-900, Brazil 2 Departamento de Engenharia e Tecnologia de Alimentos, UNESP - Universidade Estadual Paulista, Instituto de Biociências, Letras e Ciências Exatas, São José do Rio Preto, SP, Brazil 3 Instituto de Ciências Exatas e Naturais, Universidade Federal de Mato Grosso, Rondonópolis, MT, Brazil 4 GEE, Handong Global University, Pohang, South Korea Probiotics & Antimicro. Prot. (2017) 9:334–344 DOI 10.1007/s12602-017-9260-3 http://crossmark.crossref.org/dialog/?doi=10.1007/s12602-017-9260-3&domain=pdf It is important to check for antibiotic resistance, as probiotic LAB can act as potential reservoirs of (transferable) resistance genes that can result in multidrug resistant strains [5]. Probiotics are frequently prescribed to the consumers under treatment for a variety of illnesses as an accompanying therapy. However, the beneficial effects of the probiotic strain may be reduced by possible inter- actions with the medication used by these patients/con- sumers. An important issue is that the interaction between medications or antibiotics and probiotic bacteria in the GIT depends on their concentration in this environment [6, 7]. In this regard, determination of Minimal Inhibitory Concentration (MIC) values in the interaction between probiotic LAB and drugs is an essential aspect in the evaluation of their efficacy. Special attention needs to be given to drugs for treatment of chronic diseases, since, due to their long-term application, they may accumulate in the GIT and affect the viability of probiotic LAB [8]. Production of antimicrobial peptides (bacteriocins) may be a complimentary characteristic for probiotic LAB. Bacteriocins can be involved in the reduction of patho- genic bacteria from the GIT provided these pathogens are sensitive to the produced bacteriocins. Some authors are even suggesting application of bacteriocins in the treatment of some pathogens, including multidrug resis- tant Staphylococcus aureus, Mycobacterium spp., and some viral and fungal infections in parallel to applied antibiotics [9]. However, potential cytotoxicity of the bac- teriocins may constitute a safety risk and needs more at- tention. Toxicological studies have showed that nisin in- take does not cause toxic effects to the human body with an estimated lethal dose (LD50) of 6950 mg/kg, which is similar to that of salt, when administered orally [10]. In general, some authors have associated LD50 of bacterio- cins with digest ive enzymes capable of rapidly inactivating these substances such as trypsin and chymo- trypsin produced in the pancreas [11–13]. However, dif- ferent bacteriocins can have a high variation in the mo- lecular mass and amino acid sequence, including even the presence of some non-protein subunits involved in their activity [14]; these features may interfere with their cyto- toxicity. Thus, the safety evaluation of each new bacteri- ocin, both as candidate for a medical or biopreservation application needs to be performed. In this work, we explore safety aspects of Lb. plantarum ST8Sh, a strain isolated from fermented Bulgarian salami BShpek^ [15, 16] related to the presence of genes related to virulence, antibiotic resistance and production of biogenic amines, physiological tests related to expression of some vir- ulence factors, partial purification of expressed bacteriocin/s and determination of its/their cytotoxicity, and inhibitory in- teractions between Lb. plantarum ST8Sh and some selected commercial drugs. Material and Methods Strains and Media Lb. plantarum ST8Sh, a bacteriocinogenic strain isolated from Bulgarian salami BShpek^ [15] and Listeria monocytogenes ATCC 7644, L. monocytogens ScottA, Enterococcus faecalis ATCC 19443, and Lb. sakei ATCC 15521 as test microorgan- isms, were cultured in MRS broth and BHI broth (Difco, Detroit, MI, USA), respectively, incubated at 30 °C and stored at −80 °C, in the presence of 20% glycerol. Bacteriocin Production and Partial Purification Lb. plantarum ST8Sh was cultured in MRS broth at 37 °C for 24 h. Cell-free supernatant was obtained after centrifugation at 5000 g for 10 min at 4 °C; pH was corrected to 6.0–6.5 with 1 M NaOH and treated for 10 min at 80 °C. Bacteriocin was precipitated by addition of ammonium sulfate to the cell-free supernatant to obtain 60% saturation and stirred for 4 h at 4 °C. After centrifugation for 1 h at 12000g at 4 °C, the resulting pellet was re-suspended in 100 mL of 25 mM phos- phate buffer (pH 6.5), and loaded on SepPak C18 cartridge (Waters, Millipore, MA, USA), and bacteriocin eluted with 60 and 80% iso-propanol in 25 mM phosphate buffer (pH 6.5). The active fraction was dried under vacuum (Speed-Vac, Savant, France), and the bacteriocin fraction was re-suspended in sterile distilled water and filtered using 0.22-μm pore size filter units (Waters). Bacteriocin Test Titer of the expressed bacteriocin was determined as described by Todorov et al. [15]. The cell free supernatant or semi- purified bacteriocin was serially 2× diluted in 100 mM phos- phate buffer pH 6.5, and 10 μL from each dilution has been spotted on the surface of BHI supplemented with 0.7% agar plated with 105 CFU/mL of L. monocytogenes ATCC 7644, L. monocytogens ScottA, E. faecalis ATCC 19443, or Lb. sakei ATCC 15521 (final concentration). The highest dilution presenting an inhibition zone larger than 2mmwas considered as basis for calculation of Arbitrary Units per mL (AU/ml) taking in consideration the volume of the deposited material and dilution factor. Cytotoxicity of the Expressed Bacteriocins/s Human hepatocellular carcinoma cell line (Huh7.5) (5 × 103 cells/well) were seeded into a 96-well plate and incubated for 24 h prior to treatment with semi-purified bacteriocin produced by Lb. plantarum ST8Sh. Then the supernatants were removed and substituted by 100 μL of DMEM (Du lbecco ’s Mod i f i ed Eag l e Med ium, Probiotics & Antimicro. Prot. (2017) 9:334–344 335 TermoFisher Scientific) supplemented with two different concentrations of semi-purified bacteriocin ST8Sh. After 48 h, culture media was removed and a solution of 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT; 100.0 μL) was added to each well containing the samples. Plate was incubated for 30 min at 37 °C, and MTT crystals were solubilized with 100 μL of DMSO (Dimethyl sulfoxide, Sigma), and light absorbance was measured at 570 nm. Cytotoxicity values are a percentage of the absorbance of the treated sample compared to the control (media without bacteriocin). Detection of Virulence Genes Total DNA from Lb. plantarum ST8Sh was isolated using the ZR Fungal/Bacterial DNA Kit (Zymo Research, Irvine, CA, USA) following the instructions of the manufacturer. All PCR reactions were performed using the GeneAmp® PCR Instrument System 9700 (Applied Biosystems, Foster City, USA). Lb. plantarum ST8Sh was tested for virulence genes gelE (gelatinase), hyl (hyaluronidase), asa1 (aggregation sub- stance), esp. (enterococcal surface protein), cylA (cytolisin), efaA (endocarditis antigen), ace (adhesion of collagen), vanA, vanB, vanC1, vanC2, vanC2/C3 (related to vancomycin resis- tance), ermA, ermB, ermC (related to erythromycin resis- tance), tetK, tetL, tetM, tetO, tetS (related to tetracycline re- sistance), aac(6′)-Ie-aph(2″)-Ia (related gentamycin resis- tance), aph(3′)-IIIa, ant(4′)-Ia, aph(2″)-Id, aph(2″)-Ic, aph(2″)-Ib, ant(6)-Ia (related to aminoglycosides type antibi- otics resistance), catA (chloraphenicol resistance), bcrB, bcrD, bcrR (related to bacitracin resistance), ccf, cob, cpd (related to sex pheromones), sprE (serine protease), int, intTn (transposom related) and genes for amino acid decarboxylases: hdc1 and hdc2 (both related to histidine de- carboxylase), tdc (tyrosine decarboxylase), and odc (ornithine decarboxylase), using PCR protocols of Moraes et al. [17] and Fortuna et al. [18]. Primers used for assessment of the pres- ence of virulence genes are presented in Table 1. Virulence Factors—Phenotypical Tests A culture of Lb. plantarum ST8Sh was subjected to pheno- typic tests to identify its virulence activity, according Barbosa et al. [19]. All tests were performed with different time and incubation temperature combinations in order to verify the production of the virulence factors in diverse conditions, de- tailed in the following, in three independent trials. Gelatinase production was verified by spotting 1 μL aliquots of the 24 h culture onto the surface of Luria Bertani agar (LB; Becton, Dickinson and Company - BD, Franklin Lakes, NJ, USA) supplemented with 3% (w/v) gelatin (BD) and incubated at 37 and 42 °C for 48 h, at 25 °C for 72 h, and at 10 and 15 °C for 10 days. After incubation, the plates were maintained at 4 °C for 4 h, and the hydrolysis of gelatin was recorded by the formation of opaque halos around the colonies [20]. Hemolytic activity was assessed by streaking the cultures onto trypticase soy agar (Oxoid) supplemented with defibrin- ated horse blood at 5% (v/v) and incubated at 37 and 42 °C for 24 h, 25 °C for 48 h, and 10 and 15 °C for 10 days. The hemolysis formed by each isolate was classified as total or β-hemolysis (clear halos around the colonies), partial or α- hemolysis (greenish halos around the colonies), and absent or γ-hemolysis [21]. Lipase production was assessed by spotting 1 μL of cul- tures onto LB plates (BD) supplemented with CaCl2 (Sigma- Aldrich, at 0.2%, w/v) and Tween 80 (Sigma-Aldrich, at 1%, v/v) and incubated at 37 and 42 °C for 48 h, 25 °C for 72 h, and 10 and 15 °C for 10 days. The formation of clear halos around the colonies was recorded as lipase production [22]. DNAse was identified by spotting 1 μL aliquots of the cultures onto the surface of DNAse methyl green agar (BD), and incubated at 37 and 42 °C for 48 h, 25 °C for 72 h, and 10 and 15 °C for 10 days. Positive results were identified by the formation of clear halos around the colonies [23]. Effect of Commercial Drugs and Antibiotics Lb. plantarum ST8Sh was tested for resistance to drugs, according to de Carvalho et al. [8]. Thirty-three different commercial drugs were purchased in local drugstores (Sao Paulo, Brazil and Belogradtchik, Bulgaria) and solubilized in 5 mL of sterile water to achieve the concentrations in- dicated in Table 2. Overnight culture of Lb. plantarum ST8Sh (MRS broth, 37 °C, 18 h) was mixed into MRS soft agar (1.0%, w⁄v; Difco) in order to achieve the popu- lation of 106 CFU/mL. After solidification of the agar, each drug (10 μL) was spotted onto the surface of the plates and incubated at 37 °C for 24 h. The plates were examined for the presence of inhibition zones around the spotted medi- cation, and the inhibition zones larger than 2 mm diameter were subjected to the determination of the minimal inhibi- tion concentration (MIC). Serial twofold dilutions of the drugs were prepared in sterile water, and 10 μL were spot- ted onto the surface of MRS soft agar plates, previously inoculated with Lb. plantarum ST8Sh as described before. The plates were incubated at 37 °C for 24 h and examined for the presence of inhibition zones around the spots. The MIC was calculated, based on the highest dilution that resulted in inhibition halos of at least 2 mm diameter. In a similar experimental approach, susceptibility of Lb. plantarum ST8Sh to antibiotics (Table 3) was tested by the disk diffusion test, using discs from Oxoid (Hampshire, England). The inhibitory effect of the antibiotics was expressed in millimeters of the inhibition zones [8]. 336 Probiotics & Antimicro. Prot. (2017) 9:334–344 Table 1 Primer sequences utilized in the investigation of the presence/absence for virulence factors, antibiotic resistance, and biogenic amine production Presence of virulence factor gene on genome of Lb. plantarum ST8Sh Primers (5′–3′) Virulence genes gelE − TATGACAATGCTTTTTGGGAT AGATGCACCCGAAATAATATA hyl − ACAGAAGAGCTGCAGGAAATG GACTGACGTCCAAGTTTCCAA asa1 + GCACGCTATTACGAACTATGA TAAGAAAGAACATCACCACGA esp − AGATTTCATCTTTGATTCTTG AATTGATTCTTTAGCATCTGG cylA − ACTCGGGGATTGATAGGC GCTGCTAAAGCTGCGCTT efaA − GCCAATTGGGACAGACCCTC CGCCTTCTGTTCCTTCTTTGGC ace + GAATTGAGCAAAAGTTCAATCG GTCTGTCTTTTCACTTGTTTC ermA − TCTAAAAAGCATGTAAAAGAA CTTCGATAGTTTATTAATATTAG ermB + GAAAAGTACTCAACCAAATA AGTAACGG TACTTAAATTGTTTA ermC + TCAAAACATAATATAGATAAA GCAAATATTGTTTAAATCGTCAAT tetK + TTAGGTGAAGGGTTAGGTCC GCAAACTCATTCCAGAAGCA tetL − CATTTGGTCTTATTGGATCG ATTACACTTCCGATTTCGG tetM − GTTAAATAGTGTTCTTGGAG CTAAGATATGGCTCTAACAA tetO + GATGGCATACAGGCACAGAC CAATATCACCAGAGCAGGCT tetS − TCGGTATCTTAGCACATGTTG TATYCKAYTATTTGGACGACG aac(6′)-Ie-aph(2″)-Ia + CCAAGAGCAATAAGGGCATA CACTATCATAACCACTACCG aph(3′)-IIIa − GCCGATGTGGATTGCGAAAA GCTTGATCCCCAGTAAGTCA ant(4′)-Ia − CAAACTGCTAAATCGGTAGAAGCC GGAAAGTTGACCAGACATTACGAACT aph(2″)-Id − GTGGTTTTTACAGGAATGCCATC CCCTCTTCATACCAATCCATATAACC aph(2″)-Ic − CCACAATGATAATGACTCAGTTCCC CCACAGCTTCCGATAGCAAGAG aph(2″)-Ib + CTTGGACGCTGAGATATATGAGCAC GTTTGTAGCAATTCAGAAACACCCTT ant(6)-Ia − ACTGGCTTAATCAATTTGGG GCCTTTCCGCCACCTCACCG catA + GGATATGAAATTTATCCCTC CAATCATCTACCCTATGAAT vatE − ACGTTACCCATCACTATG GCTCCGATAATGGCACCGAC bcrB − AAAGAAACCGACTGCTGATA GCTTACTTGTATAGCAGAGA bcrD − AGGATTCGGCCGAATGGCACTTGATTTTAT GTTTCTTCGCGAAATTGCCGTTATAAGTAA bcrR − AACAAACAGGGAGCGGCCGCATGGAATTTA TGATGTTCGCGATTTCATTCCCATCTGCTT ddlE − ATCAAGTACAGTTAGTCT Probiotics & Antimicro. Prot. (2017) 9:334–344 337 Results and Discussion Bacteriocin Partial Purification and Cytotoxocity Test Bacteriocin produced by Lb. plantarum ST8Sh has been par- tially purified by ammonium sulfate precipitation and hydrophobic chromatography on SepPakC18 column. The semi-purified bacteriocin showed an exceptionally high activ- ity against L. monocytogenes (102,400 AU/mL) and E. faecalis (102,400 AU/mL). Semi-purified fractions (60% iso-propanol and 80% iso-propanol) of bacteriocin ST8Sh were tested on Huh7.5 cells for their cytotoxicity profile. At Table 1 (continued) Presence of virulence factor gene on genome of Lb. plantarum ST8Sh Primers (5′–3′) ACGATTCAAAGCTAACTG aac(6′)-Ii − GCGGTAGCAGCGGTAGACCAAG GCATTTGGTAAGACACCTACG mur2ed − AACAGCTTACTTGACTGGACGC GTATTGGCGCTACTACCCGTATC mur2 − CGTCAGTACCCTTCTTTTGCAGAGTC GCATTATTACCAGTGTTAGTGGTTG ccf − GGGAATTGAGTAGTGAAGAAG AGCCGCTAAAATCGGTAAAAT cob + AACATTCAGCAAACAAAGC TTGTCATAAAGAGTGGTCAT cpd + TGGTGGGTTATTTTTCAATTC TACGGCTCTGGCTTACTA int + GCGTGATTGTATCTCACT GACGCTCCTGTTGCTTCT sprE − TTGAGCTCCGTTCCTGCCGAAAGTCATTC TTGGTACCGATTGGGGAACCAGATTGACC fsrA − ATGAGTGAACAAATGGCTATTTA CTAAGTAAGAAATAGTGCCTTGA fsrB − GGGAGCTCTGGACAAAGTATTATCTAACCG TTGGTACCCACACCATCACTGACTTTTGC fsrC − ATGATTTTGTCGTTATTAGCTACT CATCGTTAACAACTTTTTTACTG int-Tn − TGACACTCTGCCAGCTTTAC CCATAGGAACTTGACGTTCG VanA − TCTGCAATAGAGATAGCCGC GGAGTAGCTATCCCAGCATT VanB − GCTCCGCAGCCTGCATGGACA ACGATGCCGCCATCCTCCTGC VanC1 + GGTATCAAGGAAACCTC CTTCCGCCATCATAGCT VanC2 − CTCCTACGATTCTCTTG CGAGCAAGACCTTTAAG vanC1(2) − GCTGAAATATGAAGTAATGACC CGGCATGGTGTTGATTTCGTT vanC2/C3 − CTCCTACGATTCTCTTG CGAGCAAGACCTTTAAG hdc1 − AGATGGTATTGTTTCTTATG AGACCATACACCATAACCTT hdc2 − AAYTCNTTYGAYTTYGARAARGARG ATNGGNGANCCDATCATYTTRTGNCC tdc − GAYATNATNGGNATNGGNYTNGAYCARG CCRTARTCNGGNATAGCRAARTCNGTRTG odc − GTNTTYAAYGCNGAYAARCANTAYTTYGT ATNGARTTNAGTTCRCAYTTYTCNGG Positive results (+) for genes for virulence, antibiotic resistance, and biogenic amines in Lb. plantarum ST8Sh 338 Probiotics & Antimicro. Prot. (2017) 9:334–344 concentration of 25 μg/mL, 60% fraction demonstrated to be highly cytotoxic, reducing the cell viability by approximately 80%; however, when this same fraction was tested at a lower concentration (5 μg/mL), no cell cytotoxicity was observed. Regarding the 80% iso-propanol fraction, cell viability was not reduced in both tested concentrations (25 and 5 μg/mL). Moreover, it is essential to pay attention to the cytotoxicity of this and similar bacteriocins in food preparations, due to their potential of concentration depending on the effect on cell vi- ability that may result in severe side effects and tissue damage if ingested by humans or other animal bacteriocins. Analysis of bacteriocin cytotoxicity is not a routine proce- dure, and only a few studies on this issue are available in literature. In a previous study, our group demonstrated a high cytotoxicity potential of two other bacteriocins (ST202Ch and ST216Ch) on Huh7.5 cells [24]. Vaucher et al. [25] evaluated the toxicity profile of the commercial bacteriocins on epithe- lial monkey kidney cells (Vero), and it was demonstrated that at 1.04 μg/mL concentrations, nisin reduced the cell viability by 50%. Therefore, concerning cell cytotoxicity, semi-purified fractions of bacteriocin ST8Sh appear to be safer for practical use than nisin. Although their excellent potential as food pre- servatives and antibiotic substitutes, bacteriocins can also be toxic to human cells, and so, cytotoxicity assays should be included as routine in research on bacteriocins to be used as biopreservatives. Screening for the Presence of Virulence Factors Lb. plantarum ST8Sh showed a low presence of virulence genes. Only 13 genes were detected (related to sex phero- mones, aggregation substance, adhesion of collagen, tetracy- cline, gentamicin, chloramphenicol, erythromycin, but not to vancomycin and bacitracin) and may be considered as safe for application in fermented food products (Table 1). The detected frequency of possible presence of the virulence factors in Lb. Table 2 Effect of commercial drugs on the growth of Lb. plantarum ST8Sh, presented as diameter of inhibition zones in millimeters and Minimal Inhibition Concentration (MIC) Commercial name Concentration (mg/mL) Active substance Medicament class Lb. plantarum ST8Sh Inhibition zone (mm) [MIC (mg/mL)] Amoxil 100 Amoxicillin β-Lactam antibiotic (Penicillin) 32 [<0.4] Arotin 4 Paroxetine Selective serotonin reuptake inhibitor (SSRI) antidepressant 10 [2.0] Atlansil 40 Amiodarone Antiarrhythmic 14 [1.25] Cataflam 10 Diclofenac potassium Non-steroidal anti-inflammatory drug (NSAID) 10 [10.0] Diclofenaco potassico* 10 Diclofenac potassium NSAID 12 [20.0] Diclofenaco potassico* 10 Diclofenac potassium NSAID 10 [20·0] Dorflex 10 Orphenadrine citrate, Metamizole sodium, Cafein Analgesic 10 [5.0] Fenergan 5 Promethazine hydrochloride Antihistaminic 10 [5.0] Spidufen 120 Ibuprofen arginine NSAID 16 [30.0] Following commercial drugs has no effect on the growth of Lb. plantarum ST8Sh— AAS (Acetylsalicylic acid, Analgesic/Antipyretic at 20 mg/mL); Antak (Ranitidine hydrochloride, Histamine H2-receptor antagonist that inhibits stomach acid production (Proton pump inhibitor) at 30 mg/mL); Aspirina (Acetylsalicylic acid, Analgesic/Antipyretic at 100 mg/mL); Celebra (Celecoxib, NSAID at 40 mg/mL); Clorana (Hydrochlorothiazide, Diuretic at 5 mg/mL); Coristina R (Acetylsalicylic acid, Pheniramine maleate, Phenylephrine hydrochloride, Cafein, Analgesic/Antipyretic/ Antihistaminic/Decongestant at 10 mg/mL); Doxuran (Doxazosin, Antihypertensive/Treatment of prostatic hyperplasia at 0.8 mg/mL); Dramin (Dimenhydrinate, Antiemetic at 20 mg/mL); Fluimucil (Acetylcysteine, Mucolitic agent at 8 mg/mL); Flutec (Fluconazole, Antifungal at 30 mg/mL); Higroton (Chlorthalidone, Thiazide diuretic at 10 mg/mL); Neosaldina (Metamizole sodium, isometheptenemucate, cafein, Analgesic at 60 mg/mL); Nimesulida (Nimesulide, NSAID at 20 mg/mL); Nisulid (Nimesulide, NSAID at 20 mg/mL); Omeprazol (Omeprazole, Proton pump inhibitor at 4 mg/ mL); Redulip (Sibutramine hydrochloride monohydrate, Anorexiant/Sympathomimetic at 3 mg/mL); Seki (Cloperastine, Antitussives (central and periferic mode of action) at 3.54 mg/mL); Superhist (Acetylsalicylic acid, Pheniramine maleate, Phenylephrine hydrochloride, Analgesic/Antipyretic/ Antihistaminic/Decongestant at 80 mg/mL); Tylenol (Paracetamol, Analgesic/Antipyretic at 150 mg/mL); Tylex (Paracetamol, Codein, Analgesic at 6 mg/mL); Yasmin (Ethinylestradiol, drospirenone, Contraceptive at 0.6 mg/mL); Zestril (Lisinopril, Antihypertensive (Angiotensin-converting enzyme (ACE) inhibitor) at 4 mg/mL); Zocor (Simvastatin, Hypolipidemic at 2 mg/mL); and Zyrtec (Cetirizine hydrochloride, Antihistaminic at 2 mg/mL) *Produced by two different companies Probiotics & Antimicro. Prot. (2017) 9:334–344 339 plantarum ST8Sh was lower than that reported in other stud- ies on Lactobacillus spp. and Enterococcus spp. isolated from foods [19, 20, 26–28] and also in comparison to studies with clinical isolates [20, 29, 30]. Lb. plantarum ST16Pa [31] iso- lated from papaya was previously described with positive PCR results for the presence of gelE (gelatinase), hyl (hyal- uronidase), asa1 (aggregation substance), ace (adhesion of collagen), and tdc (tyrosine decarboxylase), thus representing a high virulence profile when compared to the results obtained in the present study for Lb. plantarum ST8Sh. Even when the presence of virulence factors was less rele- vant to LAB strains isolated from food, compared to LAB from clinical origin, the determination of virulence factors in LAB by molecular and phenotypic procedures is important due to the risk of gene transfer, since these factors are usually encoded by genes located in conjugative plasmids [30]. The LAB comprises a heterologous group of six families and at least 36 different genera with particular metabolism, but with common characteristics including their fermentative ability to produce lactic acid as a major end product of primary metab- olism [5, 32]. Several LAB have a long history as beneficial organisms, used in or associated with different fermentation processes and applied as probiotics [1]. However, some LAB are considered as opportunistic pathogens and have been as- sociated with some clinical cases [2–4]. Some enterococci may contain several determinants of pathogenicity, such as colonization factors that promote the adhesion of bacteria to host cells and invasion factors that promote the invasion of epithelial cells disordering the immune system [29, 33]. Different cell wall-anchored surface proteins are related to enterococcal pathogenicity, including aggregation substance, enterococcal surface protein, and collagen binding compo- nents [34]. The presence of enterococcal surface proteins, in- cluding aggregation substance, Enterococcus surface protein, adhesins, and other adhesive molecules, such as Enterococcus endocarditis antigen may facilitate close contact between cells for conjugation and subsequent transfer of virulence plasmids [34]. However, on the other side, they can be involved in better adhesion and colonization of the GIT. On the negative side, the aggregation substance protein may have a role in translocation of enterococci into epithelial cells [35] and be involved in the pathogenicity of these bacteria. A cell wall- anchored protein characterized by its ability to form biofilms, e.g., Enterococcus surface protein, may therefore be implicat- ed in enterococcal infections associated with biofilms [34]. In the last two decades, the term as quorum sensing (QS) was extensively explored and defined as an intercellular chemical signaling system in bacteria. Related to this, produc- tion and detection of compounds known as pheromones to elicit coordinated responses among members of a bacterial community was described [36]. Pheromones produced by Gram-positive bacteria comprise small peptides. These pep- tides can be related to different key regulatory processes in bacterial cells, including a variety of fundamental behaviors including conjugation, natural competence for transformation, biofilm development, and virulence factor regulation. Even if not much work has been conducted on Lactobacillus spp. related to peptide pheromones, we need to be aware that this process is relevant to all bacterial groups. Genes related to production and expression of peptide pheromones can be a part of the natural genome of bacterial species, but can be a result of the horizontal gene transfer within and between spe- cies via conjugative plasmids. Generally, conjugation, well studied in Enterococcus spp., is controlled via peptide phero- mones [36]. The possible presence of bacterial pheromone genes in Lb. plantarum ST8Sh needs to be explored in more details in order to give an answer on their exact role in the genus Lactobacillus and Lb. plantarum particularly. Are these genes a part of the natural genetic heritage of the species or are they appearing as a result of inter-bacterial interaction and horizontal gene transfer? Based on the performed phenotypic tests, Lb. plantarum ST8Sh was not expressing any of the tested virulence factors. These results can be related to the fact that expression of studied virulence factors may be related either to the specific growth condition for the tested Lb. plantarum ST8Sh strain, or to the more complex condition/interaction with different fac- tors. Or simply, most probably, the genes encoding this viru- lence factors are partially inactivated or parts of the operon are damaged or just not present. Effect of Commercial Drugs on Lb. plantarum ST8Sh Application of probiotics is related to the prevention/ prophylaxis of diseases; however, they form part of the active therapy as well. Most frequently individuals or patients taking probiotics are often treated for other illnesses, including chronic clinical cases. However, are we aware of possible interactions between viable probiotics and drugs as chemical substances? Aswe need to optimize the effect of the probiotics to the host, it is important to determine the effect of drugs on the survival of probiotic strains. As presented in Table 2, the tested Lb. plantarum ST8Sh strain was inhibited by non- steroidal anti-inflammatory drugs (NSAID) containing diclofenac potassium, ibuprofen arginine, promethazine hy- drochloride, paroxetine, amiodarone, Dorflex, an analgesic that contains orphenadrine citrate, metamizole sodium, and cafein. In addition, Lb. plantarum ST8Sh expectedly was sen- sitive to amoxyl. However, inhibition of Lb. plantarum ST8Sh needs to be considered not as qualitative interaction, but in relation of the observed MIC, presented on Table 2. In addi- tion to previous, it is important to mention that the concentra- tion of these drugs/substances in the GIT, together with MIC, is critical for their interaction with the probiotic bacteria [6, 7]. In this regard, considering that the daily dose for Spidufen is 600 mg (Zambon Laboratórios Farmacêuticos Ltda), the MIC 340 Probiotics & Antimicro. Prot. (2017) 9:334–344 value associated to the volume of the human GIT indicates that the recommended daily dose will hardly affect the surviv- al of Lb. plantarum ST8Sh. However, more important are the drugs used in the treatment of chronic diseases, since the higher concentrationsmay be accumulated in the human body, including the GIT. Atlansilis, an anti-arrhytmic drug is nor- mally used in long-term treatments; Fenergan, an antihista- minic drug, and Arotin, a drug from the group of the anti- depressants with neuroleptic effect, are also used in long- term treatments and presented an MIC of 1.25, 5.0, and 2.0 mg/mL, respectively. Due to their long-term application, these drugs may accumulate in the GITandMIC-values which may be reached that may affect viability of Lb. plantarum ST8Sh. The interaction between anti-inflammatory drugs based on diclofenac and LAB detected in this study (Table 2) was also reported previously in other studies. It has been reported that this group of drugs inhibited the growth of Lb. plantarum ST8KF and ST341LD, E. faecium ST311LD, and Leuconostoc mesenteroides subsp. mesenteroides ST33LD [31]. In a similar study, potassium diclofenac and ibuprofen inhibited the growth of Lactococcus lactis subsp. lactisHV219 [6]; Lb. casei Shirota and Lb. casei LC01 were inhibited by non-steroidal anti-inflam- matory drugs (NSAID) containing diclofenac potassium or ibu- profen arginine [8]. In addition, Carvalho et al. (11) reported that Lb. casei Shirota was affected by selective serotonin reuptake inhibitors (SSRI), an antidepressant containing paroxetine, and antiarrhythmicmedicine containing amiodarone, whileLb. casei LC01 was inhibited by hypolipidemic drugs containing simva- statin. Anti-inflammatory drugs, moderate diuretic and neuro- leptic containing potassium or sodium diclofenac, ibuprofen, triamterene hydrochlorothiaziden, and thioridazinehydrochlorid acted as inhibitors of Lb. plantarum, Lb. rhamnosus, Lb. paracasei, and Lb. pentosus strains isolated from boza and test- ed for probiotic potential [7]. It is extremely difficult to compare results working with different strains, due to the fact that Table 3 Effect of antibiotics on the growth of Lactobacillus plantarum ST8Sh, presented as diameter of inhibition zones in millimeters Antibiotic (μg/disk) Classification Inhibition zone (mm)a Ampicillin, 10 Penicillins/β-Lactam (interferes with bacteria cell wall synthesis) 38 Bacitracin, 10 Cyclic polipeptide (inhibits bacteria cell wall synthesis) 22 Cefazolin, 30 1st generation cephalosporin/β-Lactam (interferes with bacteria cell wall synthesis) 23 Cefepime, 30 4th generation cephalosporin/β-Lactam (interferes with bacteria cell wall synthesis) 21 Cefotaxim, 30 2nd generation cephalosporin/β-Lactam (interferes with bacteria cell wall synthesis) 23 Ceftazidim, 30 3th generation cephalosporin/β-Lactam (interferes with bacteria cell wall synthesis) 18 Ceftriaxon, 30 3th generation cephalosporin/β-Lactam (interferes with bacteria cell wall synthesis) 16 Cefuroxim, 30 β-Lactam (interferes with bacteria cell wall synthesis) 19 Ciprofloxacin, 5 Fluoroquinolones (inhibits the bacterial topoisomerase II) 12 Clindamicin, 2 Licosamides (inhibits protein synthesis) 32 Chloramphenicol, 30 Prevents peptide bond formation–inhibits protein synthesis) 27 Erytromicin, 15 Macrolide (inhibits protein synthesis) 21 Furazolidon, 10 Antibiotic/antiparasitic 15 Gentamicin, 10 Aminoglycoside (inhibits protein synthesis) 10 Imipenem, 10 Carbapenem/β-Lactam (interferes with bacteria cell wall synthesis) 36 Neomicin, 30 Aminoglycosides (inhibit protein synthesis) 12 Nitrofurantoin, 300 Nitrofuran derivative (nucleic acid inhibitor) 21 Ofloxacin, 5 Licosamide (inhibits protein synthesis) 12 Penicillin G, 10 β-Lactam (interferes with bacteria cell wall synthesis) 14 Rifampicin, 30 Semisynthetic compound derived from Amycolatopsisrifamycinica 25 Rifampicin, 5 Semisynthetic compound derived from Amycolatopsisrifamycinica 21 Streptomicin, 10 Aminoglycoside (inhibits protein synthesis) 20 Tetraciclin, 30 (inhibits protein synthesis) 27 Trimetoprim, 5 (Inhibits folatesyntesis) 22 Amicacin 30 μg/disk and Kanamicin 30 μg/disk (Aminoglycoside, inhibits protein synthesis), Metronidazol 50 μg/disk (Nitroimidazole antibiotic, acts on DNA of microorganisms, ameba, and protozoa), Nalidixic acid 30 μg/disk (Syntetic quinolone antibiotic, acts on DNA gyrase), Oxacilin 1 μg/disk (β-Lactam, interferes with bacteria cell wall synthesis), Tobramicin 10 μg/disk (Aminoglycoside, inhibits protein synthesis), and Vancomycin 30 μg/ disk (Glycopeptide, inhibits bacteria cell wall synthesis) are not affecting the growth of Lb. plantarum ST8Sh aAverage diameter of inhibition zones of the test microorganism Probiotics & Antimicro. Prot. (2017) 9:334–344 341 drug/bacteria interactions are strain specific, this also being ob- served when authors explored different strains of the same spe- cies in one study [7]. However, it is interesting and also impor- tant to compare results obtained with some commercial and/or reference strains as reported by different research groups. Botes et al. [37] found that Lb. casei Shirota was inhibited by several commercial antibiotics, in addition to the anti-inflammatory drugs containing meloxican (Coxflam), Ibuprofen (Dolocyl, Adco-Ibuprofen), potassium diclofenac (Cataflam), and prednis- olone (Preflam) that also inhibited the strain growth, to a lesser extent. Pinmed, containing paracetamol, codeine phosphate, and promethazine HCl, misclassified as analgesic instead of an an- titussive agent, was also inhibitory to L. casei Shirota. The same authors also reported the inhibitory effect of Pynmed, more like- ly due to the presence of alcohol in the formulation than to the drug itself [37]. This is another important point that needs to be taken into account—the composition of the drug preparation and the presence and composition of the accompanying sub- strate or solvent. Among the tested drugs in this study, the anti-inflammatory medical preparations were those that affected Lb. plantarum ST8Sh more significantly. These results are in agreement with previous studies, investigating other potential probiotics and commercial LAB probiotics [6–8, 37, 38]. Taking into con- sideration the composition of the mentioned drugs, their in- hibitory activity may be related to an increased concentration of potassium ions in the gastric content as a result of the dissociation of potassium diclofenac in the GIT. The excess of potassium ions in the environment is incompatible with microbial cell viability and may have a negative effect on LAB. Other potassium-based drugs may cause a similar neg- ative effect. Individuals under permanent therapy with drugs should be aware that these drugs may reduce the beneficial effects of the probiotic bacteria. Resistance to Antibiotics The majority of the investigated antibiotics in this study inhibited the growth of Lb. plantarum ST8Sh (Table 3). Growth of Lb. plantarum ST8Sh was not affected by the pres- ence of Amicacin (30 μg/disk) and Kanamicin (30 μg/disk) (Aminoglycoside, inhibits protein synthesis), Metronidazol (50 μg/disk) (Nitroimidazole antibiotic, acts on DNA of mi- croorganisms, amoeba, and protozoa), Nalidixic acid (30 μg/ disk) (Synthetic quinolone antibiotic acts on DNA gyrase), Oxacilin (1 μg/disk) (β-Lactam, interferes with bacteria cell wall synthesis), Tobramicin (10 μg/disk) (Aminoglycoside, inhibits protein synthesis), and Vancomicin (30 μg/disk) (Glycopeptide, inhibits bacteria cell wall synthesis). Resistance of potential probiotic LAB candidates to antibi- otics is a controversial subject, as these strains may be reser- voirs of antibiotic resistance genes, and can be transferred horizontally to other bacteria in the human and other animals GIT [5]. However, from another point of consideration, resis- tance to antibiotics can be considered as a positive aspect, since such LAB strains (carrying resistance to a specific anti- biotic) could be applied in combination with such an antibiotic potentially resulting in synergism between the antibiotic and the LAB strain in the treatment of the diseases. Resistance may be inherent to a bacterial genus or species, but may also be acquired through exchange of genetic material, mutations, and the incorporation of new genes [23, 39–41]. Presence of genes related to tetracycline, gentamicin, chlor- amphenicol, erythromycin antibiotic resistance was detected in Lb. plantarum ST8Sh. Lactobacilli have a high natural (constitutive) resistance to different antibiotics, including gen- tamicin [42]. In addition, many strains of Lb. plantarum are intrinsically resistant to the antibiotic, due to the presence of D-alanine-D-alanine ligase related enzymes [43]. Salminen et al. [44] showed that strains of Lactobacillus isolated from blood samples had low MIC values to erythromycin in addi- tion to other antibiotics. However, lactobacilli are generally susceptible to antibiotics interfering with protein synthesis, e.g., chloramphenicol, erythromycin, clindamycin and tetra- cycline, but are more resistant to aminoglycosides (neomycin, kanamycin, streptomycin, and gentamicin) [45–47]. In gener- al, lactobacilli show resistance to most inhibitors of nucleic acid synthesis, including enoxacin, pefloxacin, norfloxacin, nalidixic acid, sulphamethoxazole, trimethoprim, co- trimoxazole, and metronidazole [45, 46]. Herreros et al. [48] reported on resistance to tetracycline in Lb. plantrum isolated from Armada cheese. Tetracycline resistance was recorded for several strains of Lb. plantarum isolated from raw milk soft cheeses [23]. Lb. plantarum isolated from Bhome-made^ Spanish cheese (Serena, Gamonedo and Cabrales) revealed resistance to penicillin G, cloxacillin, streptomycin, gentamycin, tetracycline, erythromycin, and chloramphenicol [49]. Regarding gentamicin, MIC values detected in wine iso- lates of Lb. plantarum were in general very high. A similar observation was reported by Elkins and Mullis [50] in who found intrinsic resistance of lactobacilli to aminoglycosides to be due to membrane impermeability, probably complemented by potential efflux mechanisms. In general, Lb. plantarum showed higher MICs for aminoglycosides than other LAB genera and Lactobacillus species [51]. Conversely, Zhou et al. [47] found almost all out of ten tested Lb. plantarum strains to be resistant to gentamicin. The antibiotic resistance genes provide elevated competi- tion potential to a strain to survive and constitute a positive attribute to survival and adaptation. From the human point of view, these genes are generally undesirable. Lactobacilli are generally susceptible to antibiotics inhibiting the synthesis of proteins, such as chloramphenicol, erythromycin, clindamycin, and tetracycline, and more resistant to aminogly- cosides (neomycin, kanamycin, streptomycin, and gentami- cin) [5]. However, strains resistant to these antibiotic agents 342 Probiotics & Antimicro. Prot. (2017) 9:334–344 have also been identified [5], and several genes providing such resistance have been studied; e.g., a chloramphenicol resistance gene (cat) has been detected in Lb. plantarum [52]. Also, different erythromycin-resistance genes (erm) have been found in many species, as well as a number of tetracy- cline resistance genes [5]. The tetS gene in the probiotic Lb. plantarum strain CCUG 43738 was found to be located on a plasmid of 14-kbp [53]. The major financial and societal costs caused by the in- crease in antibiotic resistance in pathogenic microorganisms are a general issue of concern. The attenuation of this problem is complicated by commercial bacteria that may act as reser- voirs for antibiotic resistance determinants found in pathogens [40, 54]. This statement is supported by the fact that the same type of genes encoding resistance to, for example, tetracy- cline, erythromycin, chloramphenicol, streptomycin, and streptogramin, have been found in commercial lactococci and lactobacilli as well as in potentially pathogenic enterococ- ci and pathogenic streptococci [23]. A most important simi- larity in resistance genes has also been observed for tetracycline-resistance in Lb. plantarum and other LAB [5, 55]. Conclusions Besides, all beneficial properties studied for various LAB, most considered as GRAS, special attention needs to be given to the possible presence of virulence factors, production of biogenic , and antibiotic resistance. These virulence determi- nants have been detected and well studied in enterococci and streptococci; however, in the last few years, reports on the presence of virulence factors in otherwise GRAS lactobacilli have indicated potential upcoming problems. Horizontal gene transfer of virulence factors between pathogenic and LAB, including probiotics, appears to be a highly possible scenario in case of uncontrolled application of probiotics. Complex research of all aspects of potential new probiotics strains and antimicrobial peptides is essential in order to ensure safety application of these strains and/or their metabolites. Acknowledgements This work has been supported by research and personal grants from FAPEMIG (Belo Horizonte, MG, Brazil), CAPES (Brasilia, DF, Brazil), and CNPq (Brasilia, DF, Brazil). To Braga A.C.S. and Batista M.N. from UNESP — Universidade Estadual Paulista, Instituto de Biociências, Letras e Ciências Exatas. Departamento de Engenharia e Tecnologia de Alimentos, São José do Rio Preto, SP, Brazil for technical assistance related to cytotoxicity of bacteriocin work. Compliance with Ethical Standards Conflict of Interest The authors declare that they have no conflict of interest. References 1. Martinez RCR, Vieira ADS, Santos KMO, Franco BDGM, Todorov SD (2012) Characterization and evaluation of Lactobacillus plantarum probiotic potential. In: AIP C, Mena AL (eds) Lactobacillus: classification, uses and health implications, Bacteriology Research Developments / Microbiology Research Advances series. Nova Publishers, New York, USA, pp 36–63 2. Doern CD, Nguyen ST, Afolabi F, Burnham C-AD (2014) Probiotic-associated aspiration pneumonia due to Lactobacillus rhamnosus. J Clin Microbiol 52:3124–3126 3. Goldstein EJC, Tyrrell KL, Citron DM (2015) Lactobacillus spe- cies: taxonomic complexity and controversial susceptibilities. Clin Infect Dis 60:S98–S107 4. Schwendicke F, Dörfer C, Kneist S, Meyer-Lueckel H, Paris S (2014) Cariogenic effects of probiotic Lactobacillus rhamnosus GG in a dental biofilm model. Caries Res 48:186–192 5. Dicks LMT, Todorov SD, Franco BDGM (2011) Current status of antibiotic resistance in lactic acid bacteria. In: Bonilla AR, Muniz KP (eds) Antibiotic resistance: causes and risk factors, mechanisms and alternatives. Pharmacology—research, safety testing and regu- lation. Nova Publisher, New York, USA, pp 379–425 6. Todorov SD, Botes M, Danova ST, Dicks LMT (2007) Probiotic properties of Lactococcus lactis subsp. lactisHV219, isolated from human vaginal secretions. J Appl Microbiol 103:629–639 7. Todorov SD, Botes M, Guigas C, Schillinger U, Wiid I, Wachsman MB, Holzapfel WH, Dicks LMT (2008) Boza, a natural source of probiotic lactic acid bacteria. J Appl Microbiol 104:465–477 8. De Carvalho KG, Kruger MF, Furtado DN, Todorov SD, Franco BDGM (2009) Evaluation of the role of environmental factors in the human gastrointestinal tract on the behaviour of probiot ic cul tures Lactobaci l lus case i Shiro ta and Lactobacillus casei LC01 by the use of a semi-dynamic in vitro model. Ann Microbiol 59:439–445 9. Bogsan CS, Nero LA, Todorov SD (2015) From traditional knowl- edge to an innovative approach for bio-preservation in food by using lactic acid bacteria.Chapter 01. In: Liong M-T (ed) Beneficial microorganisms in Food & Nutraceuticals. Springer, New York, NY, USA, pp 1–36 10. Jozala AF, De Andrade MS, De Arauz LJ, Pessoa A Jr, Penna TCV (2007) Nisin production utilizing skimmed milk aiming to reduce process cost. Appl Biochem Biotechnol 137-140:515–528 11. Deegan LH, Cotter PD, Hill C, Ross P (2006) Bacteriocins: biolog- ical tools for bio-preservation and shelf-life extension. Int Dairy J 16:1058–1071 12. Motta AS, Cannavan FS, Tsai S-M, Brandelli A (2007) Characterization of a broad range antibacterial substances from a new Bacillus species isolated from Amazon basin. Arch Microbiol 188:367–375 13. Vaucher AR, Gewehr CVC, Correa FAP, Sant'Anna V, Ferreira J, Brandelli A (2011) Evaluation of the immunogenicity and in vivo toxicity of the antimicrobial peptide P34. Int J Pharm 421:94–98 14. Klaenhammer TR (1988) Bacteriocins of lactic acid bacteria. Biochimie 70:337–349 15. Todorov SD, Holzapfel W, Nero LA (2016) Characterization of a novel bacteriocin produced by Lactobacillus plantarum ST8SH and some aspects of its mode of action. Ann Microbiol 66:949–962 16. Todorov SD, Holzapfel WH, Nero LA (2016) In Vitro evaluation of beneficial properties of bacteriocinogenic Lactobacillus plantarum ST8Sh. Probiotics & Antimicrobial Proteins. doi:10.1007/s12602- 016-9245-7. (in press) 17. Moraes PM, Perin LM, Todorov SD, Silva A Jr, Franco BDGM, Nero LA (2012) Bacteriocinogenic and virulence potential of Enterococcus isolates obtained from raw milk and cheese. J Appl Microbiol 113:318–328 Probiotics & Antimicro. Prot. (2017) 9:334–344 343 http://dx.doi.org/10.1007/s12602-016-9245-7.%20(in%20press) http://dx.doi.org/10.1007/s12602-016-9245-7.%20(in%20press) 18. Fortina MG, Ricci G, Borgo F, Manachini PL, Arends K, Schiwon K, Abajy MY, Grohmann E (2008) A survey on biotechnological potential and safety of the novel Enterococcus species of dairy origin, E. italicus. Int J Food Microbiol 123:204–211 19. Barbosa J, Gibbs PA, Teixeira P (2010) Virulence factors among enterococci isolated from traditional fermented meat products pro- duced in the north of Portugal. Food Control 21:651–656 20. Eaton TJ, Gasson MJ (2001) Molecular screening of Enterococcus virulence determinants and potential for genetic exchange between food and medical isolates. Applied and environmental Microbiology 67:1628–1635 21. Favaro L, BasagliaM, Casella S, Hue I, Dousset X, Franco BDGM, Todorov SD (2004) Bacteriocinogenic potential and safety evalua- tion of non-starter enterococcus faecium strains isolated from home made white brine cheese. Food Microbiol 38:228–239 22. Favaro L, Corich V, Giacomini A, Basaglia M, Casella S (2013) Grape marcs as unexplored source of new yeasts for future biotech- nological applications. World J Microbiol Biotechnol 29:1551– 1562 23. Smith PB, Hancock GA, Rhoden DL (1969) Improved medium for detecting deoxyribonuclease-producing bacteria. Appl Microbiol 18:991–993 24. Carneiro BM, Braga ACS, Batista MN, Rahal P, Favaro L, Penna ALB, Todorov SD (2014) Lactobacillus plantarum ST202Ch and Lactobacillus plantarum ST216Ch—what are the limitations for application? Journal of Nutritional Health and Food Engineering 1(2):00010 25. Vaucher RA, Teixeira ML, Brandelli A (2010) Investigation of the cytotoxicity of antimicrobial peptide P40 on eukaryotic cells. Curr Microbiol 60:1–5 26. Gomes BC, Esteves CT, Palazzo ICV, Darini ALC, Felis GE, Sechi LA, Franco BDGM, de Martinis ECP (2008) Prevalence and char- acterization of Enterococcus spp. isolated from Brazilian foods. Food Microbiol 25:668–675 27. Teuber M (1999) Spread of antibiotic resistance with food-borne pathogens. Cell Molecular Life Science 56:755–763 28. Todorov SD, Franco BDGM, Wiid IJ (2013) In vitro study of ben- eficial properties and safety of lactic acid bacteria isolated from Portuguese fermented meat products. Benefic Microbes 5:351–366 29. De Sousa CP (2003) Pathogenicity mechanisms of prokaryotic cells: an evolutionary view. Braz J Infect Dis 7:23–31 30. Franz CM, Muscholl-Silberhorn AB, Yousif NMK, Vancanneyt M, Swings J, Holzapfel WH (2001) Incidence of virulence factors and antibiotic resistance among enterococci isolated from food. Appl Environ Microbiol 67:4385–4389 31. Todorov S, Wachsman M, Ts I-I, Ivanova I (2014) Lactobacillus plantarum ST16Pa—are we ready to use it as bio-preservative cul- ture? Bulgarian Journal of Agricultural Science 20:55–58 32. Holzapfel WH, Wood BJB (2014) Introduction to the LAB. Chapter 1. In: Holzapfel WH, Wood BJB (eds) Lactic acid bacte- ria—biodiversity and taxonomy. John Wiley & Sons Ltd., Chichester, West Sussex, UK, pp 1–12 33. Franz CMAP, Stiles ME, Schleifer K-H, Holzapfel WH (2003) Enterococci in foods—a conundrum for food safety. Int J Food Microbiol 88:105–122 34. Hendrickx APA, Willems RJL, Bonten MJM, van Schaik W (2009) LPxTG surface proteins of enterococci. Trends Microbiol 17:423–430 35. Franz CMAP, Holzapfel WH (2004) The genus Enterococcus: bio- technological and safety issues. In: Salminen S, von Wright A, Ouwehand A (eds) The lactic acid bacteria: microbiology and func- tional aspects, 3rd edn. New York, Marcel Dekker, pp 199–247 36. Cook LC, Federle MJ (2014) Peptide pheromone signaling in Streptococcus and Enterococcus. FEMS Microbiol Rev 38: 473–492 37. Botes M, Van Reenen CA, Dicks LMT (2008) Evaluation of Enterococcus mundtii ST4SA and Lactobacillus plantarum 423 as probiotics by using a gastro-intestinal model with infant milk formulations as substrate. Int J Food Microbiol 128:362–370 38. Todorov SD, Dicks LMT (2008) Evaluation of lactic acid bacteria from kefir, molasses and olive brine as possible probiotics based on physiological properties. Ann Microbiol 58:661–670 39. Ammor MS, Flórez AB, Mayo B (2007) Antibiotic resistance in non-enterococcal lactic acid bacteria and bifidobacteria. Food Microbiol 24:559–570 40. Levy SB, Marshall B (2004) Antibacterial resistance worldwide: causes, challenges and responses. Nat Med 10:S122–S129 41. Salyers AA, Gupta A, Wang Y (2004) Human intestinal bac- teria as reservoirs for antibiotic resistance genes. Trends Microbiol 12:412–416 42. DanielsenM,Wind A (2003) Susceptibility of Lactobacillus spp. to antimicrobial agents. Int J Food Microbiol 82:1–11 43. Elisha BG, Courvalin P (1995) Analysis of genes encoding d-ala- nine: d-alanine ligase-related enzymes in Leuconostoc mesenteroides and Lactobacillus spp. Gene 152:79–83 44. Salminen MK, Rautelin H, Tynkkynen S, Poussa T, Saxelin M, Valtonen V, Jarvinen A (2006) Lactobacillus bacteremia, species identification, and antimicrobial susceptibility of 85 blood isolates. Clin Infect Dis 42:35–44 45. Charteris WP, Kelly PM, Morelli L, Collins JK (1998) Development and application of an in vitro methodology to deter- mine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species in theupper human gastrointestinal tract. Jornal of Applied Microbiolog 84:759–768 46. Coppola R, SucciM, Tremonte P, Reale A, SalzanoG, Sorrentino Z (2005) Antibiotic susceptibility of Lactobacillus rhamnosus strains isolated from Parmegiano Reggiona cheese. Lait 85:193–204 47. Zhou JS, Pillidge CJ, Gopal PK, Gill HS (2005) Antibiotic suscep- tibility profiles of new probiotic Lactobacillus and Bifidobacterium strains. Int J Food Microbiol 98:211–217 48. Herreros MA, Sandoval H, González L, Castro JM, Fresno JM, Tornadijo ME (2005) Antimicrobial activity and antibiotic resis- tance of lactic acid bacteria isolated from armada cheese (a Spanish goats’ milk cheese). Food Microbiol 22:455–459 49. Herrero M, Mayo B, Ganzales B, Suarez JE (1996) Evaluation of technologically important traits in lactic acid bacteria isolated from spontaneous fermentations. J Appl Bacteriol 81:565–570 50. Elkins CA, Mullis LB (2004) Bile-mediated aminoglycoside sensi- bility in Lactobacillus species likely results from increased mem- brane permeability attributable to cholic acid. Appl Environ Microbiol 70:7200–7209 51. Rojo-Bezares B, Sáenz Y, Poeta P, Zarazaga M, Ruiz-Larrea F, Torres C (2006)Assessment of antibiotic susceptibility within lactic acid bacteria strains isolated from wine. Int J Food Microbiol 111: 234–240 52. Ahn C, Collins-Thompson D, Duncan C, Stiles ME (1992) Mobilization and location of the genetic determinant of chloram- phenicol resistance from Lactobacillus plantarum caTC2R. Plasmid 27:169–176 53. Huys G, D’Haene K, Swings J (2006) Genetic basis of tetracycline and minocycline resistance in potentially probiotic Lactobacillus plantarumstrain CCUG 43738. Antimicrob Agents Chemother 50:1550–1551 54. Salyers AA, Shoemaker NB (1996) Resistance gene transfer in anaerobes: new insights, new problems. Clin Infect Dis 23: S36–S43 55. dos Santos KMO, Vieira ADS, Buriti FCA, do Nascimento JCF, de Melo MES, Bruno LM, Borges MF, Rocha CRC, Lopes ACS, Franco BDGM, Todorov SD (2015) Artisanal Coalho cheeses as source of beneficil Lactobacillus plantarum and Lactobacillus rhamnosus strains. Dairy Science & Technology 95:209–230 344 Probiotics & Antimicro. Prot. (2017) 9:334–344 http://refhub.elsevier.com/s0168-1605(14)00285-2/rf0065 Safety of Lactobacillus plantarum ST8Sh and Its Bacteriocin Abstract Introduction Material and Methods Strains and Media Bacteriocin Production and Partial Purification Bacteriocin Test Cytotoxicity of the Expressed Bacteriocins/s Detection of Virulence Genes Virulence Factors—Phenotypical Tests Effect of Commercial Drugs and Antibiotics Results and Discussion Bacteriocin Partial Purification and Cytotoxocity Test Screening for the Presence of Virulence Factors Effect of Commercial Drugs on Lb. plantarum ST8Sh Resistance to Antibiotics Conclusions References