Contents lists available at ScienceDirect Veterinary Microbiology journal homepage: www.elsevier.com/locate/vetmic Species level identification of coagulase negative Staphylococcus spp. from buffalo using matrix-assisted laser desorption ionization–time of flight mass spectrometry and cydB real-time quantitative PCR Lucas J.L. Pizauroa,1, Camila C. de Almeidab,1, Glenn A. Soltesc,1, Durda Slavicd, Oswaldo D. Rossi-Juniora, Fernando. A. de Ávilab, Luiz. F. Zafalone, Janet I. MacInnesc,⁎ a Department of Veterinary Preventive Medicine and Animal Reproduction, São Paulo State University (Unesp), School of Agricultural and Veterinarian Sciences, Jaboticabal, Brazil b Department of Veterinary Pathology, São Paulo State University (Unesp), School of Agricultural and Veterinarian Sciences, Jaboticabal, Brazil c University of Guelph, Department of Pathobiology, 50 Stone Rd. East, Guelph, Ontario, N1G 2W1, Canada d Animal Health Laboratory, University of Guelph, Post Office 3612, Guelph, Ontario, N1H 6R8, Canada e Brazilian Agricultural Research Corporation (EMBRAPA), Embrapa Southeast Livestock, Washington Luiz road, Km 234, 13560-970, Sao Carlos, Sao Paulo, Brazil A R T I C L E I N F O Keywords: cydB qPCR MALDI-TOF MS Staphylococcus agnetis Staphylococcus hyicus Milk A B S T R A C T Incorrect identification of Staphylococcus spp. can have serious clinical and zoonotic repercussions. Accordingly, the aim of this study was to determine if matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) and/or cydB real- time quantitative PCR (qPCR) could be used to accurately identify coagulase negative Staphylococcus spp. (CoNS) obtained from buffalo milk and milking environment samples. Seventy-five of 84 CoNS isolates could be identified to the species level (score value>1.99) using MALDI-TOF MS. However, as determined by cytochrome d ubiquinol oxidase subunit II (cydB) qPCR and by 16S RNA and cydB gene sequencing, 10 S. agnetis strains were wrongly identified as S. hyicus by MALDI-TOF MS. In addition, 9 isolates identified by MALDI-TOF only to the genus level (score values between 1.70 and 1.99) could be identified to species by cydB qPCR. Our findings suggest that MALDI-TOF MS is a reliable method for rapid identification of S. chromogenes and S. epidermidis (species of interest both in human and veterinary medicine) and may be able to correctly identify other Staphylococcus spp. However, at present not all Staphylococcus spp. found in buffalo milk can be accurately identified by MALDI-TOF MS and for these organisms, the cydB qPCR developed in the current study may provide a reliable alternative method for rapid identification of CoNS species. 1. Introduction Buffalo milk and milk products are of growing importance in the dairy industry worldwide (Camargo et al., 2015). Recent studies have suggested that CoNS can be significant mastitis causing-agents in buffalo (El-Jakee et al., 2013). For example, in studies of Chavoshi and Husaini (2012), coagulase negative staphylococci (CoNS) were the most frequently isolated pathogens in buffalo subclinical mastitis in Iran. In Italy, 66% subclinical mastitis in buffalos were caused by CoNS (Moroni et al., 2006). Staphylococcus spp. can cause a variety of pathological effects on the mammary gland. For example, coagulase negative Staphylococcus species (CoNS) can induce a mild inflammatory reaction and a modest increase in milk somatic cell counts (SCC) in dairy cattle (Schukken et al., 2009). Thought to act mainly as minor mastitis pathogens, CoNS are also reported to block udder infection by major mastitis pathogens (Piepers et al., 2013). Staphylococcus spp. can be transmitted by food products including milk and affect healthy people. Like Staphylococcus aureus, some CoNS species secrete enter- otoxins that are responsible for food poisoning (Nunes et al., 2016). Identification of CoNS can be a very difficult and time consuming task. Failure to identify staphylococcal species can have serious clinical and zoonotic repercussions (Martins and Cunha, 2007). Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI- TOF MS) can differentiate microorganisms based on their protein profiles. Increasingly, MALDI-TOF MS is being used in human medicine and more recently, in veterinary medicine. MALDI-TOF MS is reported http://dx.doi.org/10.1016/j.vetmic.2017.03.036 Received 30 August 2016; Received in revised form 22 March 2017; Accepted 22 March 2017 ⁎ Corresponding author. 1 These authors contributed equally to this work. E-mail address: macinnes@uoguelph.ca (J.I. MacInnes). Veterinary Microbiology 204 (2017) 8–14 0378-1135/ © 2017 Elsevier B.V. All rights reserved. MARK http://www.sciencedirect.com/science/journal/03781135 http://www.elsevier.com/locate/vetmic http://dx.doi.org/10.1016/j.vetmic.2017.03.036 http://dx.doi.org/10.1016/j.vetmic.2017.03.036 mailto:macinnes@uoguelph.ca http://dx.doi.org/10.1016/j.vetmic.2017.03.036 http://crossmark.crossref.org/dialog/?doi=10.1016/j.vetmic.2017.03.036&domain=pdf to correctly identify 95% of the CoNS species and is considered a rapid and reliable method of identification (Randall et al., 2015). Compared with classical microbiological methods, molecular tech- niques such as qPCR may offer greater specificity for the identification of microorganisms (Britten, 2012). However, to date, no standard methodology has been widely accepted for the identification of the causative agents of mastitis (Tomazi et al., 2014). An RFLP test for groEL gene has been developed, but it is time consuming (Santos et al., 2008). Similarly, amplicon PCR sequencing-based tests based on the tuf (Hwang et al., 2011), sodA (Poyart et al., 2001) and rpoB genes are time consuming and expensive. In this study, we used the well-conserved gene cydB together with MALDI-TOF MS to identify CoNS to the species level. The cydB primer sets developed provide a new approach to complement MALDI-TOF and other methods for the rapid and accurate identification of CoNS to the species level. 2. Materials and methods 2.1. Sample collection A total of 320 milk samples were obtained from all 4 quarters of 80 randomly selected female buffaloes on a dairy farm located in Sao Paulo State, Brazil during the period of November 2013 to April 2014. Animals were sampled once. A mammary gland physical examination of each animal was first performed (Radostitis et al., 2007) and the milk from each mammary quarter was submitted to a strip cup test and a California Mastitis Test (CMT) (Schalm and Noorlander, 1957). Prior to collection, teats were aseptically cleaned with 70% ethanol. Samples were also collected with sterile swabs (Pro-Lab Diagnostics) from the hands of consenting milkers (n = 16), from nares and mouths of calves (n = 20), and from liners (n = 32) and stored in peptone water as described previously (Silva et al., 2000). In addition, water samples (n = 8) from two water hoses used to clean the teats were collected in sterile plastic bottles. This study was approved by the Ethics Committee on Animal Use (CEUA) Sao Paulo State University protocol number 02663/14. 2.2. Staphylococcus spp. isolation and identification A total of 10 μL of milk was streaked on 5% sheep blood agar and incubated at 37 °C for 24 and 48 h. Isolation and identification of Staphylococcus spp. were performed according to the guidelines of the National Mastitis Council (National Mastitis Council, 2004). Cultures results were classified as positive based on the presence of three or more identical colonies. After colony morphology and Gram-stain reaction analysis, the Gram-positive bacterial isolates were separated into Streptococcus spp. or Staphylococcus spp. based on the catalase test. Staphylococcus spp. (catalase positive) further underwent the coagulase test and coagulase negative isolates were designated as CoNS. Isolates were preserved in brain heart infusion broth (BHI, Becton, Dickinson and Company, Sparks, MD, USA) with 20% glycerol at −70 °C for further analyses. 2.3. MALDI-TOF MS The identification of CoNS at the species level was performed using a MALDI Bruker Biotyper system (Bruker Daltonics Inc., Billerica, MA, USA) at the Animal Health Laboratory, University of Guelph, Guelph, Ontario, Canada. Results were analyzed using Biotyper 3.0 software which included over 5500 reference spectra. For MALDI-TOF analysis, pure cultures of CoNS were grown on 5% sheep blood agar for 24 h. A small amount of bacterial growth was transferred to the spots of an MSP 96 polished steel BC target plate (Microflex LT, Bruker Daltonics/BD, Germany, USA) using a disposable loop, then 1 μL of Matrix [α-cyano-4- hydroxycinnamic acid (HCCA)] was added and the plates were air-dried 1 to 2 min at room temperature. The resultant mass spectra were analyzed and compared with the reference spectra. Bacterial identifica- tion to the species level was achieved if the score value was equal or greater than 2.00. A score value between 1.70 and 1.99 was accepted as accurate genus level identification and presumptive species level identification. 2.4. cydB qPCR qPCR primer pairs were designed based on the cydB (cytochrome d ubiquinol oxidase subunit II) gene sequences of 13 coagulase negative Staphylococcus spp. (i.e., S. epidermidis (NZ_JZUL01000001.1-1), S. haemolyticus (NZ_JFOJ01000002.1), S. warneri (ACPZ01000027.1-1), S. xylosus (NZ_CP007208.1), S. chromogenes (JMJF01000001.1), S. saprophyticus (AP008934.1-1), S. caprae (GL545272.1), S. agnetis (NZ_CP009623.1), S. hominis (NZ_AKGC01000038.1-1), S. equorum (NZ_CAJL01000020.1), S. sciuri (NZ_LDTK01000063.1), S. pasteuri (CP004014.1), S, hyicus (NZ_CP008747.1)) obtained from the NCBI nucleotide database. The cydB gene sequences of the above-mentioned Staphylococcus spp. were first aligned using the basic local alignment search tool Blast (BLAST; http://www.ncbi.nlm.nih.gov/BLAST) and CLC Sequence View 7 software to look for unique species-specific regions (Fig. 1). Based on these analyses, primers were designed using PrimerQuest software (Integrated DNA technologies, Inc. http://www. idtdna.com) to specifically amplify cydB genes in the above species (Table 1). Analyses for the detection of the cydB gene were also done by “in silico” PCR using the program http://insilico.ehu.es/PCR/ for the species that had sequences available in the program database. The predicted size and sequence (forward and reverse) of one amplicon from each primer pair was confirmed by DNA sequencing (Laboratory Sciences Division, Agriculture and Agrifood Laboratory, Guelph). 16S rRNA gene sequencing was also done to confirm the identity of one cydB qPCR positive S. hyicus and S. agnetis isolate. 2.5. DNA extraction For DNA extraction, well isolated colonies were used to inoculate tubes containing 5 mL of BHI broth. After incubation at 37 °C for 18 h, genomic DNA extraction was done using a modified method of Kuramae-Izioka (1997). One mL of bacterial culture was transferred to 2.0 mL microfuge tubes, centrifuged at 13,400 × g for 2 min, and the cell pellet re-suspended in 700 μL of extraction buffer [160 mM Tris- HCl pH 8.0, 50 mM EDTA pH 8.0, 20 mM NaCl and SDS 0.5% (w/v)]. The cell suspensions were then homogenised by vortexing and incu- bated in a water bath at 65 °C for 40 min with vortexing every 10 min. Next, 300 μL of 5 M potassium acetate was added and the homogenates were incubated in an ice bath for 30 min with inversion every 15 min. Following this incubation, the samples were removed from ice and 650 μL of a chloroform and isoamyl alcohol [24: 1(v/v)] was added. The samples were then mixed by inversion for two min and centrifuged at 13,400 × g for 10 min at 4 °C. Following centrifugation, the super- natants were transferred to new tubes and the DNA was precipitated by the addition of 1000 μL of ice-cold absolute ethanol. The DNA precipitate mixtures were mixed by inversion and placed at −20 °C overnight prior to recovery of the DNA by centrifugation at 13,400 × g for 10 min at 10 °C. The resultant DNA pellets were air dried for 30 min and suspended in 30 μL 10 μM Tris-HCl, pH 7.3, 0.1 μM EDTA (TE). 2.6. Real time PCR (qPCR) and amplicon sequence Real-time PCR primers (Table 1) were used at a concentration of 10 pmol/μL in 25 μL reaction mixtures containing 5 μL DNA and 20 μL Light Cycler 480 (LC480) Probe Master mix (Roche Diagnostics, Indianapolis, IN). Amplification was done in an LC480 real-time PCR instrument using the following cycling parameters: 1 cycle of 95 °C for 10 min, followed by 40 cycles consisting of 95 °C for 10 s, 55 °C for 20 s, and 72 °C for 25 s. Ramp rates were 4.4 °C/s, 2.2 °C/s, and 4.4 °C/s, L.J.L. Pizauro et al. Veterinary Microbiology 204 (2017) 8–14 9 http://www.ncbi.nlm.nih.gov/BLAST http://www.idtdna.com http://www.idtdna.com http://insilico.ehu.es/PCR/%20for respectively, negative (Streptococcus suis), and water controls were included with each primer pair. In addition, a melting step (predicted primers melting temperature of 62 °C) was done at the end of each run to confirm the presence of a single product. 3. Results 3.1. Microbial isolation In about 33.7% of 320 samples of milk, abundant colonies sugges- Fig. 1. Alignment of cydB genes from selected CoNS. L.J.L. Pizauro et al. Veterinary Microbiology 204 (2017) 8–14 10 tive of Staphylococcus spp. were observed. Single colonies were steaked onto TSA agar for further testing. Based on their Gram, catalase and coagulase test reactions, 84 independent coagulase negative Staphylococcus spp. were isolated from milk (n = 57), liners (n = 10), milker hands (n = 12), and calves (n = 5). 3.2. Species level identification by MALDI-TOF MS Analysis of the 84 CoNS samples by MALDI-TOF MS revealed 75 belonged to one of 11 different Staphylococcus species (i.e., had a score value>1.99) namely: S. chromogenes (n = 47), S. caprae (n = 1), S. epidermidis (n = 6), S. equorum (n = 2), S. haemolyticus (n = 2), S. hominis (n = 1), S. hyicus (n = 10), S. pasteuri (n = 1), S. sciuri (n = 3), S. saprophyticus (n = 1), S. warneri (n = 1). Nine CoNS with scores of 1.7 to ≤1.99 were assigned to genus with a presumptive species identification of S. hyicus (n = 4), S. sciuri (n = 2) or S. chromogenes (n = 3). 3.3. cydB gene alignment Alignment of available gene sequences revealed that the cydB gene is well conserved in the genus Staphylococcus, but there is sufficient nucleotide variation to allow for the design of species-specific primers (Fig. 1). All of the PCR products generated using the species-specific cydB primers had 97–99% nucleotide sequence identity with the reference sequences in the NCBI nucleotide database. 3.4. Real time PCR results There was generally good correlation between the MALDI-TOF MS Fig. 1. (continued) L.J.L. Pizauro et al. Veterinary Microbiology 204 (2017) 8–14 11 and the cydB qPCR results (Table 2). However, all of the isolates that were classified as S. hyicus by MALDI-TOF MS (n = 10) were identified as S. agnetis by cydB qPCR. Their identity as S. agnetis was confirmed using16S rRNA gene sequence as the gold standards. As well, 2 of 5 S. sciuri and 3 of the 50 S. chromogenes isolates were identified only at the genus level by MALDI-TOF MS. Confirmation of their identity as S. sciuri and S. chromogenes was also verified by 16S rRNA gene sequencing. 4. Discussion In this study, 84 CoNS isolates obtained from 320 buffalo milk and milking environment samples were evaluated by MALDI-TOF MS and a novel cydB qPCR test. Although MALDI-TOF MS appears to be a reliable tool for the rapid and accurate diagnosis of S. chromogenes and S. epidermidis, S. agnetis may be misidentified as S. hyicus because reference spectra are not present in all commercially available data- bases. That said, the protein spectra of these species might be so similar that they may be difficult to differentiate by MALDI-TOF, but that remains to be established. When compared to cydB real-time PCR the identification of CoNS to the species level by MALDI-TOF MS was in agreement in 75 of 84 cases (89.3%) (Fig. 2); nine CoNS samples that had MALDI-TOF MS scores of less than 1.99 were identified to the species level by cydB qPCR and 16S rRNA gene sequencing. These findings are comparable to those of a study of 108 CoNS obtained from bovine intramammary infections. In this investigation, Tomazi et al. (2014) observed 95.4% agreement of MALDI-TOF MS and groEL PCR- RFLP results. However, problems were noted with the identification of S. saprophyticus and S. haemolyticus by MALDI-TOF. In another study, Zhu et al. (2015) reported that of 216 samples of Staphylococcus isolates identified by biochemical tests and 16S rRNA gene sequence analysis, 75% of the S. sciuri and 60% of S. caprae produced low but accurate MALDI-TOF MS Biotyper scores. Similar results were reported using MALDI-TOF for characterization of human clinical samples. Previous reports indicated that correct identification rates ranged from 74.2% to 99.3% (Dupont et al., 2010; Spanu et al., 2011; Loonen et al., 2012). In these studies, the variability of CoNS identification rates could be explained by different conditions of bacterial growth, preparation of samples, number of reference spectra present in the software database, version of the software, and design of the studies (Loonen et al., 2012; Tomazi et al., 2014) The most common isolates detected in the current study were S. chromogenes (n = 50), S. agnetis (n = 10) and S. epidermidis (n = 6). Small numbers of other staphylococcal spp. (i.e., caprae, equorum, heamolyticus, hominis, pasteuri, sciuri, saprophyticus and warneri) were also obtained. Isolation of S. chromogenes in milk samples and milking environment might be attributed to the fact that these species seem to be very well adapted to the bovine (and perhaps buffalo) mammary gland (Thorberg et al., 2009). These findings are comparable to previous reports which suggested that Staphylococcus spp. (Ali et al., 2008; Oliveira et al., 2011; Medeiros et al., 2013) including S. chromogenes, S. hyicus, S. simulans and S. epidermidis (Capurro et al., 2009) are the most commonly isolated species from cases of buffalo mastitis and buffalo milk. Although, caution should be exercised when extrapolating findings from one species to another and the fact that one buffalo herd may not be representative for herd comparison, these findings are also similar to the reports of CoNS in bovines (Santos et al., 2008). As well, S. chromogenes along with S. haemolyticus, S. epidermidis, and S. simulans is reported to be associated with persistent intramam- Table 1 Primer pairs for amplification of the cydB gene in CoNS. Gene Primer Sequence (5′-3′) Product (bp) cyd-caprae Forward ACGCAAGTAAAGCACAAGATAAG 206 Reverse CGTTAAAGCACCTGCAATTAGG cyd-epidermidis Forward GGCTGTTAATTCCAGCTTCTCT 235 Reverse TGCCATTGTCGTGTCATATCAT cyd-warneri Forward AAAGGATGAACCGGCATATCA 268 Reverse ACCATATCCAAAGAATGCGAATAAC cyd-pasteuri Forward GTTTGGGAAGTAACCAACGTATTT 229 Reverse ATGCAGCCGGAATCAACA cyd-haemolyticus Forward GCATGGTCAGTCGTCTTTCT 420 Reverse GCCCATTGAAGCATTAACACC cyd-xylosus Forward GTACGGCATTGCTGGATTATTG 282 Reverse GATACTGCGATCATAGGTGCTC cyd-saprophyticus Forward GCCAGCCTCTATCGCTTTAATA 250 Reverse CGCTAAGAATACGACTGACCAA cyd-sciuri Forward TACAGTGCTTTGGCTCTTTCT 430 Reverse GTGAACGCCATCACTTGTTTC cyd-chromogenes Forward CGCGTGGATTTAGACTGGATAG 304 Reverse CTGCCACGAAGAATGCAATTAG cyd-hyicus Forward CTCTTGATACCCGCTTCGTTAT 210 Reverse TTCGCCATCTTTAGCTCTATGG cyd-hominis Forward CACTCGCAACTGTATTGACTATCT 226 Reverse CAGAACATAAACCATTGACGCATAA cyd-equorun Forward TCCCTGATGCAGCGAAATAC 293 Reverse AACGGCTAAGAATACGACAGAC cyd-agnetis Forward CGCATAGAGCCAAAGATGAAGA 204 Reverse ACGTTAGGATTCCCGCAATTAG Table 2 Identity of coagulase negative Staphylococcus species by MALDI-TOF MS versus cydB qPCR results. Identity by qPCR No. of Isolates MALDI-TOF MS Genus Species Correlation S. chromogenes 50 3 47 94% S. epidermidis 6 0 6 100% S. hyicus 0 4 10 0% S. agnetis 14 0 0 0% S. pasteuri 1 0 1 100% S. sciuri 5 2 3 60% S. hominis 1 0 1 100% S. haemolyticus 2 0 2 100% S. warneri 1 0 1 100% S. caprae 1 0 1 100% S. saprophyticus 1 0 1 100% S. equorum 2 0 2 100% L.J.L. Pizauro et al. Veterinary Microbiology 204 (2017) 8–14 12 mary infections and an increase in somatic cell count (Fry et al., 2014) in dairy cattle. S. equorum, S. sciuri, S. cohnii, and S. saprophyticus (of environmental origin) may be acting as opportunistic mastitis patho- gens (Piessens et al., 2011) 5. Conclusions The results of the current study suggest that MALDI-TOF MS can be a reliable tool for the rapid and accurate diagnosis of S. chromogenes and S. epidermidis, but currently S. agnetis may be misidentified as S. hyicus. As well, MALDI-TOF MS may be a good method for the identification of S. pasteuri, S. hominus, S. haemolyticus, S. warneri, S. caprae, S. saprophyticus and S. equorum, but additional isolates should be analysed before this assertion can be made with confidence. To complement (or where not available, replace) MALDI-TOF MS, speciation of CoNS can be done using cydB PCR amplification. Conflict of interests The authors confirm that they have no conflicts of interest. Acknowledgements This work was conducted during a scholarship supported by the International Cooperation Program CAPES/COFECUB at the University of Guelph. Financed by CAPES – Brazilian Federal Agency for Support and Evaluation of Graduate Education within the Ministry of Education of Brazil. References Ali, L., Muhammad, G., Arshad, M., Saquib, M., Hassan, I.J., 2008. Bacteriology of mastitis in buffaloes in tehsil samundri of district faisalabad, Pakistan. Pak. Vet. J. 28, 31–33. Britten, A.M., 2012. The role of diagnostic microbiology in mastitis control programs. Vet. Clin. North Am. Food Anim. Pract. 28, 187–202. http://dx.doi.org/10.1016/j.cvfa. 2012.03.006. Camargo, G., Aspilcueta-Borquis, R., Fortes, M., Porto-Neto, R., Cardoso, D., Santos, D., Lehnert, S., Reverter, A., Moore, S., Tonhati, H., 2015. Prospecting major genes in dairy buffaloes. BMC Genomics 16, 872. http://dx.doi.org/10.1186/s12864-015- 1986-2. Capurro, A., Artursson, K., Waller, K.P., Bengtsson, B., Ericsson-Unnerstad, H., Aspán, A., 2009. Comparison of a commercialized phenotyping system, antimicrobial susceptibility testing, and tuf gene sequence-based genotyping for species-level identification of coagulase-negative staphylococci isolated from cases of bovine mastitis. Vet. Microbiol. 134, 327–333. http://dx.doi.org/10.1016/j.vetmic.2008.08. 028. Chavoshi, M., Husaini, J., 2012. Buffalo subclinical mastitis bacterial pathogens in Iran. 2nd International Conference on Biomedical Engineering and Technology IPCBEE 34, 143–146. Dupont, C., Sivadon-Tardy, V., Bille, E., Dauphin, B., Beretti, J.L., Alvarez, A.S., Degand, N., Ferroni, A., Rottman, M., Herrmann, J.L., Nassif, X., Ronco, E., Carbonnelle, E., 2010. Identification of clinical coagulase-negative staphylococci, isolated in microbiology laboratories, by matrix-assisted laser desorption/ionization-time of flight mass spectrometry and two automated systems. Clin. Microbiol. Infect. 16, 998–1004. http://dx.doi.org/10.1111/j.1469-0691.2009.03036.x. El-Jakee, J.K., Aref, N.E., Gomaa, A., El-Hariri, M.D., Galal, H.M., Omar, S. a., Samir, A., 2013. Emerging of coagulase negative staphylococci as a cause of mastitis in dairy animals: an environmental hazard. Int. J. Vet. Sci. Med. 1, 74–78. http://dx.doi.org/ 10.1016/j.ijvsm.2013.05.006. Fry, P.R., Middleton, J.R., Dufour, S., Perry, J., Scholl, D., Dohoo, I., 2014. Association of coagulase-negative staphylococcal species, mammary quarter milk somatic cell count, and persistence of intramammary infection in dairy cattle. J. Dairy Sci. 97, 4876–4885. http://dx.doi.org/10.3168/jds.2013-7657. Hwang, S.M., Kim, M.S., Park, K.U., Song, J., Kim, E.C., 2011. tuf gene sequence analysis has greater discriminatory power than 16S rRNA sequence analysis in identification of clinical isolates of coagulase-negative staphylococci. J. Clin. Microbiol. 49, 4142–4149. http://dx.doi.org/10.1128/JCM.;1;05213-11. Kuramae-Izioka, E.E., 1997. A rapid, easy and high yield protocol for total genomic DNA isolation of Colletotrichum gloeosporioides and Fusarium oxysporum. Unimar 19, 683–689. Loonen, A.J.M., Jansz, A.R., Bergland, J.N.B., Valkenburg, M., Wolffs, P.F.G., Van Den Brule, A.J.C., 2012. Comparative study using phenotypic, genotypic, and proteomics methods for identification of coagulase-negative staphylococci. J. Clin. Microbiol. 50, 1437–1439. http://dx.doi.org/10.1128/JCM.;1;06746-11. Martins, A., Cunha, M.L., 2007. Methicillin resistance in Staphylococcus aureus and coagulase-negative Staphylococci: epidemiological and molecular aspects. Microbiol. Immunol. 51, 787–795. Medeiros, E.S., Freitas, M.F.L., Pinheiro Júnior, J.W., Saukas, T.N., Krewer, C.C., Santos, A.S., Costa, M.M., Mota, R.A., 2013. Bubaline mastitis etiology in northeast of Brazil. Arq. Bras. Med. Vet. Zootec. 65, 1891–1894. http://dx.doi.org/10.1590/S0102- 09352013000600043. Moroni, P., Sgoifo Rossi, C., Pisoni, G., Bronzo, V., Castiglioni, B., Boettcher, P.J., 2006. Relationships between somatic cell count and intramammary infection in buffaloes. J. Dairy Sci. 89, 998–1003. National Mastitis Council, 2004. Microbiological Procedures for the Diagnosis of Bovine Udder Infection and Determination of Milk Quality, 4th ed. National Mastitis Council, Verona Wis. USA. Nunes, R.S.C., Pires de Souza, C., Pereira, K.S., Del Aguila, E.M., Paschoalin, V.M.F., 2016. Identification and molecular phylogeny of coagulase-negative staphylococci isolates from Minas Frescal cheese in southeastern Brazil: superantigen toxin production and antibiotic resistance. J. Dairy Sci. 1–13. http://dx.doi.org/10.3168/ jds.2015-9693. Oliveira, A.A.F., Pinheiro, J.W., Mota, R.A., Cunha, M.L.R.S., Lopes, C.A.M., Rocha, N.S., Fig. 2. Identification of CoNS by MALDI-TOF MS and cydB qPCR amplification. L.J.L. Pizauro et al. Veterinary Microbiology 204 (2017) 8–14 13 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0005 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0005 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0005 http://dx.doi.org/10.1016/j.cvfa.2012.03.006 http://dx.doi.org/10.1016/j.cvfa.2012.03.006 http://dx.doi.org/10.1186/s12864-015-1986-2 http://dx.doi.org/10.1186/s12864-015-1986-2 http://dx.doi.org/10.1016/j.vetmic.2008.08.028 http://dx.doi.org/10.1016/j.vetmic.2008.08.028 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0025 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0025 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0025 http://dx.doi.org/10.1111/j.1469-0691.2009.03036.x http://dx.doi.org/10.1016/j.ijvsm.2013.05.006 http://dx.doi.org/10.1016/j.ijvsm.2013.05.006 http://dx.doi.org/10.3168/jds.2013-7657 http://dx.doi.org/10.1128/JCM.;1;05213-11 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0050 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0050 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0050 http://dx.doi.org/10.1128/JCM.;1;06746-11 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0060 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0060 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0060 http://dx.doi.org/10.1590/S0102-09352013000600043 http://dx.doi.org/10.1590/S0102-09352013000600043 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0070 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0070 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0070 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0075 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0075 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0075 http://dx.doi.org/10.3168/jds.2015-9693 http://dx.doi.org/10.3168/jds.2015-9693 2011. Phenotype characterization of Staphylococcus species strains isolated from buffalo (Bubalus bubalis) milk. J. Vet. Diagn. Invest. 23, 1208–1211. http://dx.doi. org/10.1177/1040638711428946. Piepers, S., Schukken, Y.H., Passchyn, P., De Vliegher, S., 2013. The effect of intramammary infection with coagulase-negative staphylococci in early lactating heifers on milk yield throughout first lactation revisited. J. Dairy Sci. 96, 5095–5105. http://dx.doi.org/10.3168/jds.2013-6644. Piessens, V., Van Coillie, E., Verbist, B., Supré, K., Braem, G., Van Nuffel, A., De Vuyst, L., Heyndrickx, M., De Vliegher, S., 2011. Distribution of coagulase-negative Staphylococcus species from milk and environment of dairy cows differs between herds. J. Dairy Sci. 94, 2933–2944 10.3168/jds. 2010-3956. Poyart, C., Quesne, G., Boumaila, C., Trieu-Cuot, P., 2001. Rapid and accurate species- level identification of coagulase-negative staphylococci by using the sodA gene as a target. J. Clin. Microbiol. 39, 4296–4301. http://dx.doi.org/10.1128/JCM.39.12. 4296-4301.2001. Radostitis, O.M., Gay, C.C., Hinchcliff, K.W., Constable, P.D., 2007. Veterinary Medicine: A Textbook of the Diseases of Cattle, Horses, Sheep, Pigs, and Goats, 10th ed. Elsevier, Philadelphia, Saunders, pp. 673–762. Randall, L.P., Lemma, F., Koylass, M., Rogers, J., Ayling, R.D., Worth, D., Klita, M., Steventon, A., Line, K., Wragg, P., Muchowski, J., Kostrzewa, M., Whatmore, A.M., 2015. Evaluation of MALDI-TOF as a method for the identification of bacteria in the veterinary diagnostic laboratory. YRVSC 101, 42–49. http://dx.doi.org/10.1016/j. rvsc.2015.05.018. Santos, O.C., da, S., Barros, E.M., Brito, M.A.V.P., Carmo, M., Bastos, F., dos Santos, K.R.N., de Marval, M.G., 2008. Identification of coagulase-negative staphylococci from bovine mastitis using RFLP-PCR of the groEL gene. Vet. Microbiol. 130, 134–140. http://dx.doi.org/10.1016/j.vetmic.2007.12.009. Schalm, O.W., Noorlander, D.O., 1957. Experiments and observations leading to development of the California mastitis test. J. Am. Vet. Med. Assoc. 130, 199–204. Schukken, Y.H., González, R.N., Tikofsky, L.L., Schulte, H.F., Santisteban, C.G., Welcome, F.L., Bennett, G.J., Zurakowski, M.J., Zadoks, R.N., 2009. CNS mastitis: nothing to worry about? Vet. Microbiol. 134, 9–14. http://dx.doi.org/10.1016/j.vetmic.2008. 09.014. Silva, W.P., Destro, M.T., Landgraf, M., Franco, B.D.G.M., 2000. Biochemical characteristics of typical and atypical Staphylococcus aureus in mastitic milk and environmental samples of Brazilian dairy farms. Braz. J. Microbiol. 31, 103–106. http://dx.doi.org/10.1590/S1517-83822000000200008. Spanu, T., De Carolis, E., Fiori, B., Sanguinetti, M., D’Inzeo, T., Fadda, G., Posteraro, B., 2011. Evaluation of matrix-assisted laser desorption ionization-time-of-flight mass spectrometry in comparison to rpoB gene sequencing for species identification of bloodstream infection staphylococcal isolates. Clin. Microbiol. Infect. 17, 44–49. http://dx.doi.org/10.1111/j.1469-0691.2010.03181.x. Thorberg, B.M., Danielsson-Tham, M.L., Emanuelson, U., Persson Waller, K., 2009. Bovine subclinical mastitis caused by different types of coagulase-negative staphylococci. J. Dairy Sci. 92, 4962–4970. http://dx.doi.org/10.3168/jds.2009- 2184. Tomazi, T., Gonçalves, J.L., Barreiro, J.R., Braga, P.A., De, C., Prada, L.F.S., Eberlin, M.N., Dos Santos, M.V., 2014. Identification of coagulase-negative staphylococci from bovine intramammary infection by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 52, 1658–1663. http://dx.doi.org/10. 1128/JCM.;1;03032-13. Zhu, W., Sieradzki, K., Albrecht, V., Mcallister, S., Lin, W., Stuchlik, O., Limbago, B., Pohl, J., Rasheed, J.K., 2015. Evaluation of the Biotyper MALDI-TOF MS system for identification of Staphylococcus species. J. Microbiol. Methods 117, 14–17. http://dx. doi.org/10.1016/j.mimet.2015.07.014. L.J.L. Pizauro et al. Veterinary Microbiology 204 (2017) 8–14 14 http://dx.doi.org/10.1177/1040638711428946 http://dx.doi.org/10.1177/1040638711428946 http://dx.doi.org/10.3168/jds.2013-6644 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0095 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0095 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0095 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0095 http://dx.doi.org/10.1128/JCM.39.12.4296-4301.2001 http://dx.doi.org/10.1128/JCM.39.12.4296-4301.2001 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0105 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0105 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0105 http://dx.doi.org/10.1016/j.rvsc.2015.05.018 http://dx.doi.org/10.1016/j.rvsc.2015.05.018 http://dx.doi.org/10.1016/j.vetmic.2007.12.009 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0120 http://refhub.elsevier.com/S0378-1135(16)30246-2/sbref0120 http://dx.doi.org/10.1016/j.vetmic.2008.09.014 http://dx.doi.org/10.1016/j.vetmic.2008.09.014 http://dx.doi.org/10.1590/S1517-83822000000200008 http://dx.doi.org/10.1111/j.1469-0691.2010.03181.x http://dx.doi.org/10.3168/jds.2009-2184 http://dx.doi.org/10.3168/jds.2009-2184 http://dx.doi.org/10.1128/JCM.;1;03032-13 http://dx.doi.org/10.1128/JCM.;1;03032-13 http://dx.doi.org/10.1016/j.mimet.2015.07.014 http://dx.doi.org/10.1016/j.mimet.2015.07.014 Species level identification of coagulase negative Staphylococcus spp. from buffalo using matrix-assisted laser desorption ionization–time of flight mass spectrometry and cydB real-time quantitative PCR Introduction Materials and methods Sample collection Staphylococcus spp. isolation and identification MALDI-TOF MS cydB qPCR DNA extraction Real time PCR (qPCR) and amplicon sequence Results Microbial isolation Species level identification by MALDI-TOF MS cydB gene alignment Real time PCR results Discussion Conclusions Conflict of interests Acknowledgements References