Brief Communication

Xenooplasmic Transfer between Buffalo and Bovine Enables
Development of Homoplasmic Offspring

Marcos Roberto Chiaratti,1 Christina Ramires Ferreira,1,2 Flávio Vieira Meirelles,1 Simone Cristina Méo,2,3

Felipe Perecin,1,2 Lawrence Charles Smith,4 Márcio Leão Ferraz,5 Manoel Francisco de Sá Filho,6

Lindsay Unno Gimenes,6 Pietro Sampaio Baruselli,6 Bianca Gasparrini,7 and Joaquim Mansano Garcia2

Abstract

Nuclear-mitochondrial incompatibilities may be responsible for the development failure reported in embryos
and fetuses produced by interspecies somatic cell nuclear transfer (iSCNT). Herein we performed xenooplasmic
transfer (XOT) by introducing 10 to 15% of buffalo ooplasm into bovine zygotes to assess its effect on the
persistence of buffalo mitochondrial DNA (mtDNA). Blastocyst rates were not compromised by XOT in com-
parison to both in vitro fertilized embryos and embryos produced by transfer of bovine ooplasm into bovine
zygotes. Moreover, offspring were born after transfer of XOT embryos to recipient cows. Buffalo mtDNA
introduced in zygotes was still present at the blastocyst stage (8.3 vs. 9.3%, p¼ 0.11), indicating unaltered
heteroplasmy during early development. Nonetheless, no vestige of buffalo mtDNA was found in offspring,
indicating a drift to homoplasmy during later stages of development. In conclusion, we show that the buffalo
mtDNA introduced by XOT into a bovine zygote do not compromise embryo development. On the other hand,
buffalo mtDNA was not inherited by offspring indicating a possible failure in the process of interspecies mtDNA
replication.

Introduction

Oocyte cytoplasm (ooplasm) carries critical compo-
nents for supporting the initial stages of development

when the embryo itself shows limited transcriptional activity,
including reprogramming factors with the capacity of re-
modeling a somatic nucleus into an undifferentiated one after
somatic cell nuclear transfer (SCNT) (Wilmut et al., 1997).
However, development failure is common after SCNT, espe-
cially after interspecies SCNT (iSCNT), and its causes remain
widely unknown. SCNT generates reconstructed oocytes with
a mixture of mitochondria from different origins (e.g., het-
eroplasmy), that often disappear to generate offspring that are
in most cases homoplasmic for mitochondria donated by the
host ooplast (Ferreira et al., 2007; Hiendleder et al. 2003, 2005;
Meirelles et al., 2001; Steinborn et al., 1998).

Mitochondrial function is driven by the interaction of two
genomes: the nuclear (nDNA) and the mitochondrial
(mtDNA). Although the role of the mtDNA is to encode
polypeptides that assemble the enzymatic subunits of oxi-
dative phosphorilation (the pathway responsible for ATP in
the mitochondrion), most of the polypeptides in oxidative
phosphorilation as well as those regulating mtDNA repli-
cation and transcription are encoded by the nDNA. Thus, the
polypeptides encoded by the nDNA must match specific
sequences in the mtDNA (e.g., the displacement loop or
d-loop) and the mtDNA-encoded polypeptides to enable
mitochondrial function to occur normally; otherwise, the cell
viability may be compromised (reviewed by Smith et al.,
2005). In this regard, it is plausible to propose that the pro-
cedure of iSCNT leads to nuclear–mitochondrial incompati-
bilities that prevent embryo development and birth of

1Departamento de Ciências Básicas, FZEA-USP, Pirassununga-SP, Brazil.
2Departamento de Medicina Veterinária Preventiva e Reprodução Animal, FCAV-UNESP, Jaboticabal-SP, Brazil.
3Embrapa Pecuária Sudeste, São Carlos-SP, Brazil.
4CRRA, Université de Montréal, Saint-Hyacinthe-QC, Canada.
5Vida Reprodutiva Consultoria, Cravinhos-SP, Brazil.
6Departamento de Reprodução Animal, Universidade de São Paulo, São Paulo-SP, Brazil.
7DISCIZIA, Federico II University, Napoli, Italy.
The first two authors contributed equally to this article.

CELLULAR REPROGRAMMING
Volume 12, Number 3, 2010
ª Mary Ann Liebert, Inc.
DOI: 10.1089=cell.2009.0076

231



healthy offspring (Chen et al., 2002; Gómez et al., 2009; Hua
et al., 2007; Kitiyanant et al., 2001; Lanza et al., 2000; Lu et al.,
2005; Mastromonaco et al., 2007; Saikhun et al., 2002). The
issue of a nuclear–mitochondrial incompatibility has been
studied using xenomitochondrial cybrid models produced
by the fusion of a somatic cell with a cytoplast (e.g., a cell
previously enucleated) of another species (Kenyon and
Moraes, 1997; Trounce and Pinkert, 2007) and using SCNT to
analyze effects during embryo=fetal development in both
inter- (Chen et al., 2002; Gómez et al., 2009; Lanza et al., 2000;
Loi et al., 2001; Mastromonaco et al., 2007) or intraspecific
(Bowles et al., 2008; Ferreira et al., 2007; Hiendleder et al.
2003, 2005; Meirelles et al., 2001; Steinborn et al., 1998) ani-
mal models. However, various factors involved in SCNT
success (e.g., ooplasmic factors involved in somatic nucleus
dedifferentiation) could prevent proper conclusions. In this
context, it would be preferable to study the relationship be-
tween nDNA and mtDNA by transfer of ooplasm between
individuals during early stages of development. Herein we
have transferred ooplasm donated by buffalo (Bubalus buba-
lis) ooplasts into bovine (Bos indicus) zygotes to study the
mitochondrial inheritance in embryos and offspring.

Materials and Methods

The present study was approved by the Institutional
Animal Care and Use Committee of the São Paulo State
University (UNESP) at the Jaboticabal Campus (protocol
number 017256-06). All chemicals and reagents used were
purchased from Sigma-Aldrich Chemical Co. (St. Louis, MO,
USA) unless otherwise stated. In vitro experimental proce-
dures were performed in humidified incubators maintained
at 38.58C in air with 5% CO2.

In vitro maturation (IVM), in vitro fertilization (IVF), ovum
pickup (OPU), parthenogenetic activation, enucleation, elec-
trofusion, in vitro culture (IVC) of embryos, and embryo
transfer were performed as described in Ferreira et al. (2007).
Briefly, oocytes obtained postmortem from the ovaries of
crossbred cows (B. indicus nDNA and B. taurus mtDNA)
were IVM for 24 h and after 12 h of IVF were denuded of
cumulus cells by pipetting in 0.5% hyluronidase, and se-
lected by the presence of the second polar body (2nd PB),
which were used as recipient zygotes for XOT. Meanwhile,
donor ooplasts obtained by OPU from 10 female buffaloes
(B. bubalis) were subjected to IVM for 21 h in the presence
of 50 mM cysteamine and 0.3 mM cistine, and selected by the
presence of the first polar body (1st PB) after removal of
cumulus cells. The metaphase II spindle and the 1st PB were
removed by microsurgery, and enucleated oocytes parthe-
nogenetically activated 26 h post-IVM. To provide space for
donor ooplasts, recipient zygotes had the 2nd PB and sur-
rounding cytoplasm removed by microsurgery. After 12 to
16 h postparthenogenetic activation, 10 to 15% of ooplasm
from the donor ooplast was microinjected in the perivitelline
space and electrofused to the recipient zygote. One ooplast
was used as donor ooplasm to reconstruct up to seven re-
cipient zygotes. Reconstructed embryos (referred to as ‘‘XOT
group’’) were IVC, and development rates were assessed
based on blastocyst development after 7 days of culture. This
rate was compared to that of IVF embryos that were previ-
ously selected for 2nd PB before IVC (referred to as ‘‘IVF
group’’) and to that of IVF embryos that received cytoplasm

from bovine oocytes previously activated (referred to as ‘‘OT
group’’). The same procedure used to perform XOT was used
to produce embryos in the OT group. Moreover, to evaluate
development to term, three blastocysts obtained by XOT
were nonsurgically transferred to the uterus of three previ-
ously synchronized recipient cows, and were naturally de-
livered after normal gestation length.

The sperm used for IVF and offspring were genotyped
following recommendation of the International Society for
Animal Genetics. Briefly, sperm and blood (from offspring)
samples had total genomic DNA extracted following a
standard procedure (Ferreira et al., 2007). The genetic iden-
tity between the calves and the sperm was determined by
microsatellite analysis using 11 microsatellite markers
(Genoa Biotecnologia AS, São Paulo, SP, Brazil).

The inheritance of the mtDNA introduced by XOT was
assessed in zygotes (at the pronuclear stage), at day 7 of IVC
(blastocyst stage) and in offspring (0, 10, 30, and 290 days
after birth). Embryos were randomly sampled (nine zygotes
and six blastocysts), washed in phosphate-buffered solution
(PBS), and placed in 0.2-mL polystyrene microtubes con-
taining 1mL of PBSþ 0.1% polyvinyl-pyrrolidone (PVP),
snap-frozen in liquid nitrogen, and stored at �808C until use.
Embryos pertaining to the OT group (13 zygotes and 11
blastocysts) also had their total number of mtDNA copies
analyzed to be used as control in the experiment. Tissue
samples (blood, skin, muscle, and liver) were collected from
offspring, placed in 1.8-mL cryotubes, and stored at �808C
until use. Moreover, eight oocytes were collected by OPU
(see above) from each offspring (after 18 months of birth) and
stored as described for embryos.

For molecular analysis, oocyte and embryo samples were
treated as described by Chiaratti et al. (2010), whereas tissue
samples had the genomic DNA extracted following a stan-
dard procedure (Ferreira et al., 2007). The proportion of
buffalo mtDNA was determined by quantitative polymerase
chain reaction (qPCR) using a discriminating (buffalo
mtDNA) assay and normalization for a nondiscriminating
(buffaloþ bovine mtDNAs) assay (Ferreira et al., 2010). For
discrimination of buffalo and bovine mtDNAs (GenBank:
AY702618, AY126697 and AY526085), species-specific dif-
ferences in their MT-RNR2 genes sequences were targeted.
The nondiscriminating assay used the primers bMT3010-f
(50-GCCCTAGAACAGGGCTTAGT) and bMT3096-r (50-
GGAGAGGATTTGAATCTCTGG) in combination with the
TaqMan probe bMT3030-Fam (50-FAM-AAGGTGGCAGAG
CCCGGTAATTGC-BHQ1). The discriminating assay used
the primers bbMT2971-f (50-GCCTTAAAACAACTAATG
AATTT, discriminating nucleotides are underlined) and
bMT3096-r, and the probe bMT3030-Fam. qPCR reactions
were performed in duplicate in a 20-mL reaction containing
900 nM of forward (discriminating or nondiscriminating
assay) and reverse primers (Applied Biosystems, Foster
City, CA, USA)þ 250 nM probe (Applied Biosystems)þ 1�
TaqMan Gene Expression Master Mix (Applied Biosystems)þ
5 mL of template. Cycling conditions consisted of a first
step at 958C for 15 min followed by 40 cycles of 958C for
20 sec and 638C for 1 min. The ABI PRISM SDS 7500 HT
Real-Time PCR System (Applied Biosystems) was used for
qPCR reactions. Both discriminating and nondiscriminat-
ing assays were always run in the same PCR plate. The stan-
dard curve method was used to determine the percentage

232 CHIARATTI ET AL.



of buffalo mtDNA. Assay sensitivity was estimated to be
0.01% of buffalo mtDNA. The total number of copies mtDNA
(buffaloþ bovine) and the number of copies of buffalo
mtDNA were also assessed in embryos (zygote and blasto-
cyst stages) following the procedure described by Chiaratti
et al. (2010).

Statistical analysis was performed using the SAS System
(V8, Cary, NC, USA). Development rates were compared
using w2. The percentage of buffalo mtDNA and the number
of mtDNA copies in embryos were compared between zy-
gote and blastocyst stages using a Student’s t-test. Differ-
ences with probabilities ( p)< 0.05 were considered
significant. In the text, values are reported as mean� the
standard error of the mean (SEM).

Results and Discussion

Interspecies SCNT is envisaged to rescue endangered an-
imals whose oocytes are difficult to obtain. However, off-
spring generated by this procedure will contain mostly the
mtDNA donated by the ooplast (Ferreira et al., 2007; Hien-
dleder et al. 2003, 2005; Meirelles et al., 2001; Steinborn et al.,
1998). The use of ooplasts from a more abundant related
species (e.g., slaughterhouse-derived cattle oocytes for en-
dangered artiodactyls) could lead to incompatible interac-
tions between the nDNA and the mtDNA (Bowles et al.,
2008; Gómez et al., 2009; Kenyon and Moraes, 1997;
Lanza et al., 2000; Loi et al., 2001; Trounce and Pinkert, 2007).
In this regard, XOT is a valuable tool to study nuclear–
mitochondrial interaction between species.

The procedure of iSCNT has been used without much
success. Most reports show that the embryo is capable of
developing to the blastocyst stage or even until later stages
but not to derive viable offspring (Chen et al., 2002; Gómez
et al., 2009; Hua et al., 2007; Kitiyanant et al., 2001; Lanza
et al., 2000; Lu et al., 2005; Mastromonaco et al., 2007; Sai-
khun et al., 2002). Two main factors related to the ooplasm
could be taken into account to explain iSCNT inefficiency:
(1) its incapacity for remodeling the somatic nucleus into a
totipotent one, (2) an incompatibility between mtDNA
and nDNA. Herein we focused on the second possibility,
because an incompatibility between these two genomes
could compromise the mitochondrion-dependent mecha-
nism of ATP generation in the cell and therefore lead to
a development arrest (Bowles et al., 2008; Gómez et al.,
2009; Kenyon and Moraes, 1997; Lanza et al., 2000; Loi et al.,
2001; Trounce and Pinkert, 2007). Our study was based on
a model where 10 to 15% of buffalo ooplasts are transferred
into bovine zygotes. Because we intended to evaluate in-
terspecies mtDNA inheritance in offspring, XOT was
chosen rather than iSCNT due to the low efficiency of the
latter in generating live offspring (Chen et al., 2002; Gómez
et al., 2009; Hua et al., 2007; Kitiyanant et al., 2001; Lanza
et al., 2000; Lu et al., 2005; Mastromonaco et al., 2007; Sai-
khun et al., 2002). Moreover, introduction of amounts of
ooplasm larger than 10–15% might drastically modify the
zygote’s cytoplasm composition, leading to development
arrest as well. On the other hand, introduction of somatic
cytoplast might lead to a more stringent segregation of
somatic mtDNA due to specific differences between so-
matic and ooplasmic mitochondria (Bowles et al., 2008;
Ferreira et al., 2007).

In our study, embryo development was not compromised
by the transfer of buffalo ooplasm into bovine zygotes.
Blastocyst rate of IVF (65=235, 27.7%), OT (75=314, 23.9%),
and XOT (15=66, 22.7%) embryos were not different
( p¼ 0.53). Moreover, XOT did not prevent development to
term after embryo transfer to recipient cows enabling birth of
female twins (Fig. 1). Analysis of microsatellite markers
confirmed that offspring were generated with the sperm
used in IVF and twins were genetically identical, probably
due to embryo splitting after transfer to recipient cows. Al-
though previous studies have shown development to blas-
tocyst after iSCNT using bovine ooplasts and buffalo nucleus
(Kitiyanant et al., 2001; Lu et al., 2005; Saikhun et al., 2002),
transfer of xenoembryos to surrogate females was not per-
formed. Using a somatic cell model, studies on xenomi-
tochondrial cybrids have shown that with increased
evolutionary divergence a barrier is reached whereby the
foreign mtDNA can no longer be maintained, so that cybrids
are not viable (Kenyon and Moraes, 1997; Trounce and Pin-
kert, 2007). Moreover, there are significant evidences that
increased evolutionary distance is detrimental to embryo=
fetal development after iSCNT (Bowles et al., 2008; Gómez
et al., 2009; Lanza et al., 2000; Loi et al., 2001). Although the
unaltered development to blastocyst and to term in our
model indicates proper nuclear–mitochondrial interactions,
another possible interpretation is that buffalo mtDNA does
not interfere with development because (1) mitochondrial
activity is low during the early stages of embryogenesis and
(2) the majority (85 to 90%) of the mitochondria in the XOT
zygotes is of bovine origin.

Comparison between buffalo and bovine mtDNAs showed
that they differ by 12% in sequence (based on Genbank se-
quences, see above), whereas the difference in the replication
origin and in the d-loop reaches 7 and 19%, respectively. This
may compromise the subsistence of buffalo mtDNA once
mitochondrial replication and transcription is initiated, and
undermined by inefficient nuclear–mitochondrial interac-
tions. To test this hypothesis we checked whether blastocysts
produced by XOT retain the donor mtDNA (Fig. 2). The
average number of buffalo mtDNA copies present at the
zygote stage was 43,157� 5708 (range: 11,097 to 74,492) and

FIG. 1. Twin calves born after transfer of buffalo ooplasm
into bovine zygotes.

XENOOPLASMIC TRANSFER 233



the average number of total mtDNA was 580,636� 76,545
(range: 271,156 to 1,130,818). Therefore, the percentage of
buffalo mtDNA present in XOT zygotes was 8.3%� 1.26
(range: 1.9–14.9%), which is rather smaller than the amount
of buffalo ooplast transferred (10–15%). One explanation is
that mitochondria distribution among donor and host zy-
gotes was different, for example, more concentrated in the
bovine zygote, leading to the introduction of less buffalo
mtDNA than expected. In pigs, it is known that mitochon-
dria are remodulated shortly after fertilization, leading to a
heterogeneous cytoplasmic distribution during the one-cell
stage (Sun et al., 2001).

In comparison to zygotes, buffalo blastocysts contained
similar amounts of mtDNA molecules (48,425� 6,470; range:
32,940–69,595; p¼ 0.56). Moreover, because no amplification
of the total amount of mtDNA was observed between zy-
gotes (see above) and blastocysts (539,701� 61,896; range:
271,156–702,536; p¼ 0.72), the percentage of buffalo mtDNA
(blastocysts¼ 9.3%� 1.07; range: 6.2–12.1%) did not change
( p¼ 0.11). A similar result was observed ( p¼ 0.13) in con-
trol embryos subjected to OT using bovine ooplasm (OT
group) (zygote¼ 580,636� 77,963 and blastocyst¼ 832,926�
147,634; Fig. 2). Although mtDNA amounts do not change
during in vivo preimplantation development (Kameyama
et al., 2007; Pikó and Taylor, 1987; Smith et al., 2005; Stein-

born et al., 1998), embryos cultured in vitro often show in-
creased mtDNA amounts between zygote and blastocyst
stages in a number of species (Chiaratti et al., 2010;
Kameyama et al., 2007; May-Panloup et al., 2005; McConnell
and Petrie, 2004; Mtango et al., 2008; Smith et al., 2005;
Spikings et al., 2007) including after iSCNT within the Bos
genus, for example, B. gaurus and B. taurus (Mastromonaco
et al., 2007). Nonetheless, although variations in embryo
in vitro culture systems may account for part of the differ-
ences in mtDNA levels (Kameyama et al., 2007; McConnell
and Petrie, 2004; Mtango et al., 2008), complete lack of am-
plification of donor mtDNA in these XOT embryos during
in vitro development may further reflect the nuclear-
mitochondrial incompatibilities (Bowles et al., 2008; Gómez
et al., 2009; Kenyon and Moraes, 1997; Lanza et al., 2000; Loi
et al., 2001; Trounce and Pikert, 2007) between the phylo-
genetically distant Bubalus and Bos genera (MacEachern et al.,
2009). Moreover, detailed screening for buffalo mtDNA in
offspring using a real-time protocol able to detect as little as
0.01% of buffalo mtDNA, was unsuccessful in identifying any
vestige of buffalo mtDNA in somatic (blood, skin, muscle,
and liver) and germline (oocytes) tissues of both calves born
from XOT. Ferreira et al. (2010), using a similar approach to
that described in the present work, have performed ooplas-
mic transfer between B. indicus and B. taurus cows and found

FIG. 2. Stable amounts of buffalo mtDNA during early development of XOT embryos. (a) Number of copies and (b)
percentage of buffalo mtDNA, and (c) total (buffaloþ bovine) number of copies of mtDNA in XOT embryos. (d) Total
number of copies of mtDNA in OT embryos. Dots indicate the number of mtDNA copies in each embryo and bars represent
the means. Comparisons between stages did not detect differences ( p> 0.05).

234 CHIARATTI ET AL.



that the introduced mtDNA was inherited by all offspring
generated. Moreover, even when very small amounts of cy-
toplasm are transferred by ooplasmic transfer as performed
in women in the past, the donor mtDNA can be detected in
babies (Barrit et al., 2001; Brenner et al., 2000). Mitochondrial
function is tightly dependent on polypeptides encoded by
the nDNA that are imported by the mitochondrion after
being translated in the cytoplasm. These polypeptides pro-
mote both replication and transcription of the mtDNA, and
assemble the enzymatic subunits of the oxidative phospho-
rilation together with polypeptides encoded by the mtDNA
(reviewed by Smith et al., 2005). Thus, the complete disap-
pearance of the donor mitochondria in all postnatal tissues
further indicates that buffalo mtDNA were unable to estab-
lish a functional interaction with the bovine nDNA, thereby
preventing its propagation during development.

In conclusion, transfer of buffalo ooplasm into bovine
zygotes enables birth of healthy offspring that do not inherit
the mtDNA introduced. These results are relevant to a better
understanding of nuclear–mitochondrial interactions be-
tween species. Further studies addressing this issue will be
necessary to clarify the consequences of genetic diversity on
iSCNT and its potential therapeutic applications, such as in
deriving interspecific human embryonic stem cells.

Acknowledgments

The authors gratefully acknowledge the help provided by
Dr. M.S. Miranda, J.R. Sangalli, and R. Vantini. This work was
supported by research grants (2002=05054-7, 2004=01841-0
and 2006=59074-0) from FAPESP, São Paulo, SP, Brazil.

Author Disclosure Statement

The authors declare that no conflicting financial interests
exist.

References

Barrit, J.A., Brenner, C.A., Malter, H.E., et al. (2001). Mitochon-
dria in human offspring derived from ooplasmic transfer.
Hum. Reprod. 16, 513–516.

Bowles, E.J., Tecirlioglu, R.T., French, A.J., et al. (2008). Mito-
chondrial DNA transmission and transcription after somatic
cell fusion to one or more cytoplasts. Stem Cells 26, 775–782.

Brenner, C.A., Barrit, J.A., Willadsen, S., et al. (2000). Mitochon-
drial DNA heteroplasmy after human ooplasmic transplanta-
tion. Fertil. Steril. 74, 573–578.

Chen, D.Y., Wen, D.C., Zhang, Y.P., et al. (2002). Interspecies
implantation and mitochondria fate of panda–rabbit cloned
embryos. Biol. Reprod. 67, 637–642.

Chiaratti, M.R., Bressan, F.F., Ferreira, C.R., et al. (2010). Embryo
mitochondrial DNA depletion is reversed during early em-
bryogenesis in cattle. Biol. Reprod. 82, 76–85.

Ferreira, C.R., Meirelles, F.V., Yamazaki, W., et al. (2007). The
kinetics of donor cell mtDNA in embryonic and somatic donor
cell-derived bovine embryos. Cloning Stem Cells 9, 618–629.

Ferreira, C.R., Burgstaller, J.P., Perecin, F.P., et al. (2010). Pro-
nounced segregation of donor mitochondria introduced by
bovine ooplasmic transfer to the female germ-line. Biol.
Reprod. 82, 563–571.

Gómez, M.C., Pope, C.E., Ricks, D.M., et al. (2009). Cloning
endangered felids using heterospecific donor oocytes and in-
terspecies embryo transfer. Reprod. Fertil. Dev. 21, 76–82.

Hiendleder, S., Zakhartchenko, V., Wenigerkind, H., et al.
(2003). Heteroplasmy in bovine fetuses produced by intra- and
inter-subspecific somatic cell nuclear transfer: neutral segre-
gation of nuclear donor mitochondrial DNA in various tissues
and evidence for recipient cow mitochondria in fetal blood.
Biol. Reprod. 68, 159–166.

Hiendleder, S., Zakhartchenko, V., Wolf, E. (2005). Mitochon-
drial and the success of somatic cell nuclear transfer cloning:
from nuclear-mitochondrial interactions to mitochondrial
complementation and mitochondrial DNA recombination.
Reprod. Fertil. Dev. 17, 69–83.

Hua, S., Zhang, Y., Song, K., et al. (2007). Development of
bovine–ovine interspecies cloned embryos and mitochondria
segregation in blastomeres during preimplantation. Anim.
Reprod. Sci. 105, 245–257.

Kameyama, Y., Filion, F., Yoo, J.G., et al. (2007). Characterization
of mitochondrial replication and transcription control during
rat early development in vivo and in vitro. Reproduction 133,
423–432.

Kenyon, L., Moraes, C.T. (1997). Expanding the functional hu-
man mitochondrial DNA database by the establishment of
primate xenomitochondrial cybrids. Proc. Natl. Acad. Sci.
USA 94, 9131–9135.

Kitiyanant, Y., Saikhun, J., Chaisalee, B., et al. (2001). Somatic
cell in buffalo (Bubalus bubalis): effects of interspecies cyto-
plasmic recipients and activation procedures. Cloning Stem
Cells 3, 97–104.

Lanza, R.P., Cibelli, J.B., Diaz, F., et al. (2000). Cloning of an
endangered species (Bos gaurus) using interspecies nuclear
transfer. Cloning 2, 79–90.

Loi, P., Ptak, G., Barboni, B., et al. (2001). Genetic rescue of an
endangered mammal by cross-species nuclear transfer using
post-mortem somatic cells. Nat. Biotechnol. 19, 962–964.

Lu, F., Shi, Deshu, S., et al. (2005). Development of embryos
reconstructed by interspecies nuclear transfer of adult fibro-
blasts between buffalo (Bubalus bubalis) and cattle (Bos indicus).
Theriogenology 64, 1309–1319.

MacEachern, S., McEwan, J., Goddard, M. (2009). Phylogenetic
reconstruction and the identification of ancient polymorphism
in the Bovini tribe (Bovidae, Bovinae). BMC Genomics 10, 177.

Mastromonaco, G.F., Favetta, L.A., Smith, L.C., et al. (2007). The
influence of nuclear content on developmental competence of
gaur�cattle hybrid in vitro fertilized and somatic cell nuclear
transfer embryos. Biol. Reprod. 76, 514–523.

May-Panloup, P., Vignon X., Chrétien, M-F., et al. (2005).
Increase of mitochondrial DNA content and transcripts in
early bovine embryogenesis associated with upregulation of
mtTFA and NRF1 transcription factors. Reprod. Biol. En-
docrinol. 3, 65.

McConnell, J.M., Petrie, L. (2004). Mitochondrial DNA turnover
occurs during preimplantation development and can be
modulated by environmental factors. Reprod. Biomed. Online
9, 418–424.

Meirelles, F.V., Bordignon, V., Watanabe, Y., et al. (2001).
Complete replacement of the mitochondrial genotype in a Bos
indicus calf reconstructed by nuclear transfer to a Bos taurus
oocytes. Genetics 158, 351–356.

Mtango, N.R., Harvey, A.J., Latham, et al. (2008). Molecular
control of mitochondrial function in developing rhesus mon-
key oocytes and preimplantation-stage embryos. Reprod.
Fertil. Dev. 20, 846–859.

Pikó, L., Taylor, K.D. (1987). Amounts of mitochondrial DNA
and abundance of some mitochondrial gene transcripts in
early mouse embryos. Dev. Biol. 123, 364–374.

XENOOPLASMIC TRANSFER 235



Saikhun, J., Pavasuthipaisit, K., Jaruansuwan, M., et al. (2002).
Xenonuclear transplantation of buffalo (Bubalus bubalis) fetal
and adult somatic cell nuclei into bovine (Bos indicus) oocyte
cytoplasm and their subsequent development. Theriogenology
57, 1829–1837.

Smith, L.C., Thundathil, J., Filion, F. (2005). Role of the mito-
chondrial genome in preimplantation development and
assisted reproductive technologies. Reprod. Fertil. Dev. 17,
15–22.

Spikings, E.C., Alderson, J., St John, J.C. (2007). Regulated mi-
tochondrial DNA replication during oocyte maturation is es-
sential for successful porcine embryonic development. Biol.
Reprod. 76, 327–335.

Steinborn, R., Zakhartchenko, V., Jelyazkov, J., et al. (1998).
Composition of parental mitochondrial DNA in cloned bovine
embryos. FEBS Lett. 426, 352–356.

Sun, Q.Y, Wu, G.M., Lai, L., et al. (2001). Translocation of active
mitochondria during pig oocyte maturation, fertilization and
early embryo development. Reproduction 122, 155–163.

Trounce, I.A., Pinkert, C.A. (2007). Cybrid models of mtDNA
disease and transmission, from cells to mice. Curr. Top. Dev.
Biol. 77, 157–183.

Wilmut, I., Schnieke, A.E., McWhir, J., et al. (1997). Viable off-
spring derived from fetal and adult mammalian cells. Nature
385, 810–813.

Address correspondence to:
Marcos Roberto Chiaratti

Departamento de Ciências Básicas
FZEA-USP, Pirassununga-SP, Brazil

E-mail: chiaramr@fcm.unicamp.br

or
Christina Ramires Ferreira

Departamento de Ciências Básicas
FZEA-USP, Pirassununga-SP, Brazil

E-mail: christina@iqm.unicamp.br

236 CHIARATTI ET AL.