UNIVERSIDADE ESTADUAL PAULISTA 

“Júlio de Mesquita Filho” 

INSTITUTO DE BIOCIÊNCIAS DE BOTUCATU 

 

 

 

 

REPERCUSSÕES DA DIETA OCIDENTAL E DA 

EXPOSIÇÃO AO ÁCIDO 2,4-DICLOROFENOXIACÉTICO 

(2,4-D) SOBRE A PRÓSTATA DE CAMUNDONGOS 

 

 

 

 

 

 

 

Vanessa Aguiar Rocha 

 

Orientador: Prof. Dr. Wellerson Rodrigo Scarano 

Co-orientador: Prof. Dr. Luís Fernando Barbisan 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

Botucatu – SP 

2023 

 

 



 

 

 

 
UNIVERSIDADE ESTADUAL PAULISTA 

“Júlio de Mesquita Filho” 

INSTITUTO DE BIOCIÊNCIAS DE BOTUCATU 

 

 

 

REPERCUSSÕES DA DIETA OCIDENTAL E DA 

EXPOSIÇÃO AO ÁCIDO 2,4-DICLOROFENOXIACÉTICO 

(2,4-D) SOBRE A PRÓSTATA DE CAMUNDONGOS 

 

 

 

 

 

Vanessa Aguiar Rocha 

 

Orientador: Prof. Dr. Wellerson Rodrigo Scarano 

Co-orientador: Prof. Dr. Luís Fernando Barbisan 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Botucatu – SP 

2023 

Dissertação apresentada ao Instituto de 

Biociências, Universidade Estadual 

Paulista “Júlio de Mesquita Filho”, 

Câmpus de Botucatu, para obtenção do 

título de Mestra em Biologia Geral e 

Aplicada. 

 

Prof. Dr. Wellerson Rodrigo Scarano 

 
 



Palavras-chave: 2,4-D; Herbicidas; Obesidade; Próstata;

Toxicologia reprodutiva.

Rocha, Vanessa Aguiar.

   Repercussões da dieta ocidental e da exposição ao ácido

2,4-diclorofenoxiacético (2,4-d) sobre a próstata de

camundongos / Vanessa Aguiar Rocha. - Botucatu, 2023

   Dissertação (mestrado) - Universidade Estadual Paulista

"Júlio de Mesquita Filho", Instituto de Biociências de

Botucatu

   Orientador: Wellerson Rodrigo Scarano 

   Coorientador: Luís Fernando Barbisan

   Capes: 20100000

   1. Ácido 2,4-Diclorofenoxiacético. 2. Herbicidas. 3.

Obesidade. 4. Próstata. 5. Toxicologia.

DIVISÃO TÉCNICA DE BIBLIOTECA E DOCUMENTAÇÃO - CÂMPUS DE BOTUCATU - UNESP

BIBLIOTECÁRIA RESPONSÁVEL: MARIA CAROLINA A. CRUZ E SANTOS-CRB 8/10188

FICHA CATALOGRÁFICA ELABORADA PELA SEÇÃO TÉC. AQUIS. TRATAMENTO DA INFORM.



4 
 

Agradecimentos 

 

 Agradeço a Deus por tudo.  

 A mainha e painho, Neide Aguiar e José Rocha, que me deram a vida e nunca mediram 

esforços para me proporcionar momentos especiais. Agradeço pela educação, incentivo e 

apoio incondicional em todos os momentos.  

 As minhas irmãs, Camila e Stefani, agradeço muito pelo companheirismo, amizade e 

diversão. 

 Ao meu filho de quatro patas, Brutus, por todo amor e carinho.  

 Ao meu esposo, Paulo Ricardo, obrigado por estar sempre ao meu lado, por acreditar 

e viver meus sonhos.  

 Ao meu orientador, Dr. Wellerson Rodrigo Scarano, não tenho palavras para 

agradecer pelos ensinamentos e paciência. Muito obrigada pela oportunidade e confiança.   

 Ao meu coorientador, Dr. Luís Fernando Barbisan, pela parceria e suporte no 

desenvolvimento deste projeto.   

 Aos meus amigos, companheiros de laboratório, Ariana Musa, Natália Magosso, 

Patrick Vieira, Isabelle Tenori, Mirian Aal e Vânia Nunes. Obrigada pelos bons momentos, por 

cada conversa, risos... Vocês foram os responsáveis pela minha adaptação no laboratório, me 

acolheram com muito amor e me ensinaram muito. Hoje são meus grandes amigos.  

 Aos demais colegas de laboratório, obrigada pelos momentos de descontração, amizade 

e troca de experiências. 

 Amo todos vocês, são minha família e agradeço imensamente por contribuírem para 

minha formação pessoal e profissional.  

 A CAPES – Fundação Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, 

pela concessão da bolsa de estudo e apoio financeiro a esta pesquisa. 

 Por fim, gostaria de agradecer a todos aqueles que de alguma forma contribuíram para 

que eu pudesse concluir mais esta etapa da minha vida. 

 

 

 

Obrigada! 

 

 

 

 



5 
 

LISTA DE ABREVIAÇÕES E SIGLAS 

 

2,4-D - Ácido 2,4 diclorofenoxiacético  

AR - Receptor de Andrógeno 

Casp3 - Caspase 3 

CaP – Câncer de próstata 

DEs - Desreguladores endócrinos  

DHT - Dihidrotestosterona 

DNA - Ácido desoxirribonucleico 

DNMT1 - DNA-metil-transferase 1 

DO - Dieta Ocidental 

DPN - Dia pós-natal 

EGF - “Epidermal Growth Factor” Fator de Crescimento Epidermal 

FGF - “Fibroblast Growth Factor” Fator de crescimento de fibroblastos 

FSH - Hormônios folículo estimulante  

GSR - Glutationa redutase  

H&E - Hematoxilina-Eosina  

HSS - “High sugar solution” solução de alto teor de açúcar 

HPB - Hiperplasia prostática benigna 

IDA - Ingestão Diária Aceitável  

IGF - “Insulin like Growth Factor” Fator de Crescimento Insulínico 

IL – Interleucina  

IMC - Índice de massa corpórea 

LH – Hormônio luteinizante  

MDSCs - “Myeloid-derived suppressor cell” células supressoras derivadas de mieloides 

PCNA - Antígeno nuclear de célula proliferante 

PV - Próstata ventral 

RNA - Ácido ribonucleico 

RT-qPCR - Reação em Cadeia da Polimerase em Tempo Real após Transcrição Reversa 

SOD - Superóxido dismutase 

TNF α - Fator de necrose tumoral alfa 

TTG - Teste de Tolerância a Glicose 

 

 



6 
 

RESUMO 

 A dieta ocidental (DO), rica em gorduras saturadas e carboidratos simples, está 

associada ao desenvolvimento de “patologias da civilização”, incluindo distúrbios reprodutivos 

e aumentando a probabilidade dos indivíduos desenvolverem doenças prostáticas. 

Adicionalmente, o uso de herbicidas, como o 2,4-D, um interferente endócrino, gera resíduos 

nos alimentos e em ambiente doméstico acima dos níveis permitidos. A literatura tem avaliado 

a ação desses fatores separadamente, no entanto, eles coexistem no ambiente e podem atuar 

como fatores sinérgicos, predispondo doenças crônicas sistêmicas e aumentando a 

susceptibilidade à carcinogênese. Dessa forma, como intuito de avaliar a ação do herbicida 2,4-

D sobre a próstata de camundongos expostos cronicamente à DO, camundongos machos 

C57Bl/6J receberam simultaneamente uma dieta hiperlipídica, rica em sacarose e solução de 

açúcares, e 2,4-D nas doses de 0,02, 2,0 ou 20,0 mg/kg p.c./dia por via oral, por 6 meses. Dados 

de consumo de ração, peso corpóreo e peso de gordura foram registrados. Após o tratamento, 

foi realizado o teste de tolerância à glicose (GTT) e após laparotomia, a próstata ventral foi 

coletada para avaliações histológicas e moleculares, onde a expressão gênica foi quantificada 

por RT-qPCR. Nossos resultados mostraram que a DO foi capaz de induzir obesidade nos 

animais. O tratamento com a DO aumentou o peso e a gordura corpórea, induziu intolerância a 

glicose e alterações morfológicas com modificação nos compartimentos da glândula prostática, 

aumento na quantidade de colágeno e mastócitos. A imunohistoquímica revelou aumento de 

células positivas para o PCNA (proliferação celular) no grupo DO. Na análise molecular foi 

observado aumento na expressão gênica do Ar; de importantes genes antioxidantes (Sod1, Cat, 

Gsr); de citocinas relacionadas a inflamação (Il10, Il6, Tnfα); de genes relacionados ao reparo 

e turnover celular (Tp53, Ki67, Casp3) e de alvos relacionados a metilação de DNA (Dnmt1) e 

biossíntese de miRNAs (Dicer e Drosha) no grupo DO em relação ao controle. O 2,4-D, no 

tratamento combinado, mostrou modular os parâmetros metabólicos, a morfologia prostática e 

a expressão dos genes alterados pela DO, sobretudo nas duas menores doses, assemelhando-se 

aos valores observados no controle negativo. Em contrapartida, o grupo tratado com a maior 

dose do herbicida no contexto da DO, apresentou redução no consumo da ração e redução no 

peso corpóreo, além de aumento da expressão de Ar, Ki67, Casp3 e Dnmt1 em relação ao 

controle negativo. Nossos resultados dão suporte a novas pesquisas para permitir uma melhor 

compreensão do papel do 2,4D no tratamento combinado com a DO sobre a próstata. 

Palavras-Chave: próstata, obesidade, herbicidas, 2,4-D, toxicologia reprodutiva. 

 

 



7 
 

ABSTRACT 

 The western diet (WD), high in saturated fats and simple carbohydrates, is associated 

with the development of "pathologies of civilization," including reproductive disorders and 

increasing the likelihood that individuals will develop prostate disease. Additionally, the use of 

herbicides, such as 2,4-D, an endocrine disruptor, generates residues in food and in the home 

environment above permissible levels. The literature has evaluated the action of these factors 

separately; however, they coexist in the environment and may act as synergistic factors, 

predisposing to chronic systemic diseases and increasing susceptibility to carcinogenesis. 

Therefore, in order to evaluate the action of the herbicide 2,4-D on the prostate of mice 

chronically exposed to WD, male C57Bl/6J mice received simultaneously a hyperlipidic diet, 

rich in sucrose and sugar solution, and 2,4-D at doses of 0.02, 2.0 or 20.0 mg/kg b.w./day orally 

for 6 months. Data on feed intake, body weight, and fat weight were recorded. After treatment, 

glucose tolerance test (GTT) was performed and after laparotomy, the ventral prostate was 

collected for histological and molecular evaluations, where gene expression was quantified by 

RT-qPCR. Our results showed that WD was able to induce obesity in the animals. The treatment 

with WD increased weight and body fat, induced glucose intolerance and morphological 

changes with modification in the prostate gland compartments, increased amount of collagen 

and mast cells. Immunohistochemistry revealed an increase of PCNA positive cells (cell 

proliferation) in the WD group. Molecular analysis showed increased gene expression of Ar; of 

important antioxidant genes (Sod1, Cat, Gsr); of inflammation-related cytokines (Il10, Il6, 

Tnfα); of genes related to cell repair and turnover (Tp53, Ki67, Casp3) and of targets related to 

DNA methylation (Dnmt1) and biosynthesis of miRNAs (Dicer and Drosha) in the WD group 

compared to the control. 2,4-D, in the combined treatment, was shown to modulate metabolic 

parameters, prostate morphology and expression of genes altered by WD, especially at the two 

lowest doses, resembling the values observed in the negative control. In contrast, the group 

treated with the highest dose of the herbicide in the context of WD, showed reduced feed intake 

and reduced body weight, and increased expression of Ar, Ki67, Casp3 and Dnmt1 compared 

to the negative control. Our results support further research to enable a better understanding of 

the role of 2,4-D in combination treatment with WD on the prostate. 

Keywords: prostate, obesity, herbicides, 2,4-D, reproductive toxicology. 

 

 

  



8 
 

SUMÁRIO 

LISTA DE ABREVIAÇÕES E SIGLAS ................................................................................ 5 

RESUMO ................................................................................................................................... 6 

ABSTRACT .............................................................................................................................. 7 

CAPÍTULO I ............................................................................................................................ 9 

Revisão da literatura ................................................................................................................ 9 

1. INTRODUÇÃO ............................................................................................................... 10 

1.1 Padrão de dieta ocidental e patologias associadas ..................................................... 10 

1.2 Herbicida 2,4-D ......................................................................................................... 12 

1.3 A próstata ................................................................................................................... 15 

2. JUSTIFICATIVA E RELEVÂNCIA DO TEMA ........................................................ 18 

3. OBJETIVO ...................................................................................................................... 19 

4. REFERÊNCIAS .............................................................................................................. 20 

CAPÍTULO II ......................................................................................................................... 26 

Artigo científico....................................................................................................................... 26 

2,4-dichlorophenoxyacetic acid (2,4-D) exposure during postnatal development alters the 

effects of western diet on mouse prostate ............................................................................. 27 

Abstract ................................................................................................................................... 27 

1. INTRODUCTION ........................................................................................................... 27 

2. MATERIALS AND METHODS ................................................................................... 28 

2.1 Animals ...................................................................................................................... 28 

2.2 Experimental Design .................................................................................................. 28 

2.3 Biometrics parameters ............................................................................................... 28 

2.4 Glucose tolerance test (GTT) ..................................................................................... 28 

2.5 Light Microscopy ....................................................................................................... 28 

2.6 Stereological analysis ................................................................................................ 28 

2.7 Relative volume of collagen ...................................................................................... 29 

2.8 Immunohistochemistry .............................................................................................. 29 

2.9 Evaluation of gene expression (RT-qPCR)................................................................ 29 

2.10 Statistical Analysis ..................................................................................................... 29 

3. RESULTS ......................................................................................................................... 29 

4. DISCUSSION .................................................................................................................. 33 

5. CONCLUSION ................................................................................................................ 34 

REFERÊNCIAS......................................................................................................................34 

 

 



9 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

CAPÍTULO I  

Revisão da literatura 

 



10 
 

1. INTRODUÇÃO  

1.1 Padrão de dieta ocidental e patologias associadas 

Com o avanço e domínio da tecnologia após a Revolução Industrial no século XVIII, o 

perfil nutricional da população humana mudou drasticamente [1,2]. As mudanças no 

processamento dos alimentos geraram grandes alterações nos padrões de dieta tradicionais e no 

estilo de vida, especialmente nas ultimas gerações. O crescimento na oferta de “fast food” e a 

ampliação do uso de alimentos industrializados tem contribuído com mudanças dos hábitos 

alimentares das populações nos centros urbanos. Uma pesquisa do Center for Disease Control 

entre 2013-2016 indicou que 44,9% dos adultos de 20 a 39 anos na América consumiram “fast 

food” pelo menos uma vez ao dia (Figura 1), totalizando cerca de 84,8 milhões dos adultos [3]. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figura 1: Porcentagem de adultos de 20 anos ou mais que consumiram “fast food” em um 

determinado dia nos Estados Unidos, 2013–2016. Adaptado de: Centers for Disease Control and 

Prevention (CDC) - NCHS, National Health and Nutrition Examination Survey, 2018. 

 

O padrão alimentar moderno de “dieta ocidental” (DO), disseminado principalmente em 

países desenvolvidos e em desenvolvimento, é caracterizado pelo consumo de alimentos 

processados e ultraprocessados [4]. A DO é pobre em frutas e vegetais e rica em gordura 

(principalmente as de origem animal) e sódio, além de baixa qualidade de nutrientes, alto teor 

calórico e excesso de açúcar que se concentra principalmente em bebidas (refrigerantes, 

refrescos industrializados, suco em pó e outras) [5,6]. A DO está envolvida com o aumento de 

44,90%

37,70%

24,10%

Consumo de "Fast food"

20-39 anos 40-59 anos mais de 60 anos



11 
 

doenças relacionadas aos hábitos irregulares de alimentação. O consumo alimentar inadequado 

é uma das principais causas da obesidade e da resistência à insulina, e indivíduos obesos ou 

com sobrepeso correm maior risco de desenvolver doenças crônicas [7]. Neste contexto, a DO 

é um importante fator de risco para doenças não infecciosas conhecidas como “doenças da 

civilização”, englobando doenças crônicas, cardiovasculares, hipertensão, diabetes mellitus 

tipo 2, doenças autoimunes e vários tipos de câncer [2,8,9].  

A obesidade é uma doença complexa caracterizada pelo acúmulo excessivo de gordura 

no tecido adiposo [10]. Classificada como uma patologia crônico-degenerativa e inflamatória, 

a obesidade é responsável por comprometer a saúde do indivíduo de forma sistêmica [11]. Ao 

longo das últimas décadas, a prevalência da obesidade está aumentando constantemente, 

tornando-se um grande problema de saúde pública, estando relacionada direta ou indiretamente 

às principais causas de morte em todo o mundo [12]. Dados recentes da Organização Mundial 

da Saúde (OMS) indicam que mais de um bilhão de pessoas no mundo estão acima do peso, e 

destes, mais de 40 milhões são crianças [12]. Nos EUA, entre os anos de 2000 e 2020, a 

prevalência de obesidade aumentou de 30,5% para 41,9%, e neste mesmo período a prevalência 

de obesidade grave aumentou de 4,7% para 9,2% [13]. No Brasil, dados do Vigitel (Vigilância 

de Fatores de Risco e Proteção para Doenças Crônicas em Inquérito Telefônico) apontam que 

55,4% da população estava com excesso de peso em 2019 (IMC igual ou maior do que 25), 

sendo este índice ligeiramente maior entre homens (57,1%) do que entre mulheres (53,9%) [14].  

A DO tem sido relacionada com alterações patológicas no sistema reprodutor 

masculino. Homens com maior índice de massa corpórea (IMC) estão mais propensos a ter 

parâmetros de sêmen desfavoráveis, apresentando maior incidência de azoospermia [15]. Além 

disso, dietas ricas em gordura saturada estão negativamente correlacionadas de maneira dose-

dependente com a concentração de espermatozoides [16]. Camundongos C57BL/6J expostos à 

dieta hiperlipídica (20% de banha, 10 semanas) apresentaram motilidade espermática reduzida, 

além de teratozoospermia aumentada [17]. Na mesma linhagem de camundongos, a exposição 

a dieta hiperlipídica (45% de gordura, 20 semanas) levou à redução na expressão de proteínas 

relacionadas a barreira hemato-testicular (filamina A), em resposta ao estresse oxidativo 

(spermatogenesis associated 20, SPATA-20) e metabolismo lipídico (sterol regulatory 

element-binding protein 2, SREBP2 e apolipoprotein A1, APOA1) [18]. 

Ao longo dos anos, muitos autores têm apresentado a obesidade como fator de risco para 

o câncer de próstata (CaP) e estudos que avaliaram esse parâmetro indicaram que homens com 

sobrepeso têm um risco significativamente maior de desenvolver o CaP [19-21]. Pesquisas 

demonstram que o consumo da DO induz o desenvolvimento de um microambiente pró-



12 
 

inflamatório e pró-oxidante, no qual doenças prostáticas crônicas são suscetíveis a se 

desenvolver, como a hiperplasia prostática benigna (HPB) e o câncer de próstata [22]. Em 

modelos experimentais in vivo, a alimentação com dieta hiperlipídica (58% das kcal) aumentou 

a proliferação prostática por meio de um mecanismo de ativação da cascata de sinalização 

MEK/ERK dependente de insulina, sugerindo uma possível via molecular associada aos efeitos 

epidemiológicos observados [23]. Além disso, o consumo da DO é responsável pelo aumento 

dos níveis prostáticos de fatores de transcrição do fator nuclear kappa B (NFκB), assim como 

a sua translocação para o núcleo, onde se torna efetor. Uma vez ativo, modula positivamente os 

níveis proteicos de interleucinas (IL) e mediadores pró-inflamatórios, como IL-6, IL-17, IL-1β, 

e o fator de necrose tumoral-α (TNF- α), estabelecendo um microambiente favorável ao 

estabelecimento de doenças crônicas prostáticas [24].  

 No estudo de Hayashi [25] em ratos, a dieta rica em gordura aumentou a fração de 

células supressoras derivadas de linhagem mieloide (MDSCs) e acelerou o crescimento do 

tumor de CaP via sinalização IL-6/pSTAT3 (IL-6 secretada por macrófagos prostáticos e as 

células tumorais positivas para STAT3 fosforiladas). Adicionalmente, Li e colaboradores [26] 

relataram que a indução de HPB pelo consumo de DO compromete a linha de defesa 

antioxidante das células e contribui para estresse oxidativo acentuado.  

1.2 Herbicida 2,4-D 

A Revolução Verde que teve início após a Segunda Guerra Mundial foi o marco 

responsável por introduzir técnicas inovadoras de produção no campo com uso de agrotóxicos 

nas lavouras [27]. Os agrotóxicos são amplamente utilizados em todo o mundo para aumentar 

a supremacia em uma variedade de culturas e acompanhar a demanda da população mundial 

sempre crescente. Segundo dados da Food and Agriculture Organization (FAO) [28], nas 

últimas décadas, o uso de pesticidas aumentou consideravelmente, passando de 1,68 milhões 

de toneladas em 1990 para 2,66 milhões de toneladas por ano em 2020 (Figura 2a). 

Notavelmente, o continente americano se destaca como maior consumidor de agrotóxicos no 

mundo (Figura 2b), e o Brasil ocupa o segundo lugar como maior consumidor de pesticidas 

mundialmente (377 mil toneladas/ano), atrás somente dos EUA (408 mil toneladas/ano) [28]. 

 Contrapondo a grande importância da aplicação dos agrotóxicos para a manutenção da 

produção agrícola, a disseminação desses produtos no ambiente gera uma grande preocupação 

quanto aos potenciais riscos de contaminação humana e danos à biodiversidade e à saúde dos 

ecossistemas [29]. Além dos operários que trabalham diretamente com essas substancias, os 

seres humanos de forma geral, estando no topo da cadeia alimentar, têm alta ameaça de 



13 
 

exposição aos agrotóxicos. A Organização Internacional do Trabalho (OIT) afirma que os 

agrotóxicos causam mais de sete milhões de casos de doenças agudas e crônicas não fatais e 

cerca de 70 mil intoxicações agudas e crônicas por ano que evoluem para óbito [30]. Essas 

intoxicações se concentraram em indivíduos do sexo masculino entre 15 e 49 anos, em países 

em desenvolvimento e emergentes na produção agrícola [31,32]. 

 

 

Figura 2: Gráficos representativos do uso de pesticidas no mundo (a) Uso global de pesticidas 

nos anos de 1999 à 2020, e (b)Uso de pesticidas por continente no ano de 2020. Adaptado de 

Food and Agriculture Organization of the United Nations (FAO) 2022. 

 

 Uma ampla variedade de agrotóxicos é frequentemente detectada em alimentos e 

fontes de água potável em todo o mundo, o que pode aumentar os riscos à saúde da população 

principalmente em países em desenvolvimento, onde é escasso o monitoramento quanto a 

presença de resíduos de pesticidas [33]. Os resíduos de agrotóxicos podem permanecer na 

natureza por vários anos, tornando quase impossível identificar espécies totalmente livres de 

contaminação. Toda a população está exposta a agrotóxicos por meio do consumo de alimentos 

e água contaminados, já a contaminação por meio do contato dérmico, inalação ou ingestão oral 

atinge principalmente trabalhadores que têm contato direto com agrotóxicos durante a 

manipulação, aplicação e preparo do aditivo químico [34,35]. 

 Dentre os agrotóxicos comumente utilizados na agricultura moderna, os herbicidas têm 

desempenhado um papel importante, apresentando altas taxas de sucesso no controle químico 

de plantas invasoras na produção agrícola, facilitando a vida do agricultor e contribuindo tanto 

para o aumento na produtividade quanto em áreas cultivadas [36]. Apesar de sua ampla 

utilidade na agricultura, vários estudos evidenciam que muitos desses compostos estão 

associados a uma série de resultados negativos ambientais e para a saúde humana [37]. De 

acordo com o IBAMA [28], os herbicidas mais comercializados e mais usados nas lavouras 

brasileiras, no ano de 2020, foram os formulados a base de Glifosato (246.017,51 toneladas de 

a b 



14 
 

IA) e Ácido Diclorofenoxiacético (57.597,57 toneladas de IA).  

O ácido 2,4-diclorofenoxiacético (2,4-D - Fórmula molecular: C8 H6 Cl2 O3) é uma 

auxina sintética derivada do ácido fenoxiacético [39]. Seu uso em áreas agrícolas e gramados 

iniciou-se na década de 1940, nos Estados Unidos, e atualmente mais de 1.500 produtos 

herbicidas contêm 2,4-D como ingrediente ativo [40,31]. Dados do Sistema de Agrotóxicos 

Fitossanitários – AGROFIT, vinculado ao Ministério da Agricultura, apontam que somente no 

Brasil, o 2,4-D está presente na formulação de 101 produtos registrados [42]. O 2,4-D se destaca 

no mundo dos agrotóxicos, sendo utilizado como um herbicida seletivo que em determinadas 

concentrações é letal apenas para espécies de plantas daninhas que possuem folhas largas 

(latifoliadas), levando à senescência e morte da planta [43,44]. Ele mimetiza o controle negativo 

das auxinas, fitohormônios naturais, sobre o crescimento de dicotiledôneas, mas não sobre 

monocotiledôneas [45]. Pela sua seletividade, eficiência e baixo custo, esse composto tem sido 

utilizado mundialmente em contextos agrícolas e não agrícolas, em ambientes terrestres e 

aquáticos, urbanos e rurais [41]. Desde 2001 o 2,4-D tem sido o herbicida mais comumente 

usado no mercado residencial (3,6 a 5 milhões de quilos anualmente) e o sétimo mais usado na 

agricultura [46]. 

 O 2,4-D foi o primeiro agroquímico a ser utilizado em grande escala na agricultura, e 

é frequentemente adicionado a outros herbicidas para elevar a sua eficiência [47]. Os modos de 

utilização do 2,4-D permitem que ele possa estar presente em diversas matrizes como ar, água, 

solo [41]; possuindo potencial para persistência ambiental, visto que sua meia-vida varia de 20 

a 312 dias [48]. O índice de ingestão diária aceitável (IDA) do 2,4-D definida pelas normativas 

brasileiras é 0,01 mg/kg p.c./dia, a mesma utilizada pela FAO. Na Europa, o IDA foi reduzido 

de 0,05 mg/kg para 0,02 mg/kg [49-51], e nos últimos anos, foram realizados poucos estudos 

simulando exposições a herbicidas com essas doses regulatórias relevantes. De acordo com a 

ANVISA, no Brasil, o herbicida 2,4-D não era avaliado nos alimentos até o ano de 2016 [52], 

e em 2019, a agência passou a estabelecer restrições na aplicação do agrotóxico após uma 

reavaliação toxicológica baseada em estudos científicos atuais [53].  

O 2,4-D é considerado um DEs, apresentando efeitos nocivos ao sistema endócrino, 

causando impacto sobre a comunicação endócrina e a saúde reprodutiva dos indivíduos 

expostos, podendo causar diversas alterações metabólicas e necrose tecidual em organismos 

não alvo [54,55]. Uma análise baseada nos efeitos agudos que essa substância é capaz de 

produzir após a exposição única em animais de laboratório, classificou o 2,4-D como Classe I, 

ou seja, extremamente tóxico [56], e apesar da Agência Internacional de Pesquisa sobre o 

Câncer não avaliar individualmente o 2,4D, classificou os herbicidas clorofenoxi como 

https://pubchem.ncbi.nlm.nih.gov/#query=C8H6Cl2O3


15 
 

“possivelmente carcinógeno para humanos” [57]. Um estudo de Venkov e colaboradores [58], 

relatou que o ácido 2,4-D possui efeitos citotóxicos e mutagênicos. Durante um período de 5 

dias consecutivos, estudos realizados com as doses de 1,7, 3,3 e 33 mg/kg também indicaram 

que o 2,4-D é responsável por causar anormalidades na cabeça do espermatozoide em 

camundongos e induzir alterações testiculares [59]. 

Em ratos Wistar, o tratamento com 2,4-D (gavagem, 100 ou 200 mg/kg p.c., 30 dias) 

levou a um aumento no peso dos testículos, vesículas seminais e próstata. Além disso, foi 

observado um aumento nos níveis séricos de hormônios FSH e LH, e uma redução na 

testosterona. A exposição a este herbicida induziu alterações histológicas testiculares 

pronunciadas, além de mudanças morfológicas significativas no parênquima da próstata em 

ratos tratados com 200 mg/kg, onde observou-se uma redução na altura das células epiteliais, 

afilamento da camada muscular em torno do epitélio, e alteração nas criptas de mucosa, 

aumentando o espaço luminal, revelando uma diminuição da capacidade secretora [60]. Um 

outro estudo em ratos com administração de 2,4-D (50 mg/kg/dia), também ocasionou aumento 

no peso da próstata ventral e alterações na glândula de Cowper. Esses achados podem ser 

explicados por mecanismos relacionados a resposta hormonal, como o aumento da abundância 

do receptor de andrógeno observado pela ação do 2,4-D [61]. 

No estudo de Pochettino et al. [62], ratas prenhes foram expostas diariamente a doses 

orais de 70 mg/kg/dia de 2,4-D do dia gestacional 16 ao dia pós-natal (DPN) 23, quando os 

filhotes foram desmamados. Após este período os filhotes foram alimentados com dieta 

contendo o 2,4-D até a eutanásia (DPN 45, DPN 60 e DPN 90). Este estudo mostrou que o 2,4-

D causou estresse oxidativo na próstata ventral de ratos durante todo o desenvolvimento. Uma 

pesquisa específica com culturas de células de câncer de próstata humana, revelou que o 2,4-D 

(10nm) aumentou a atividade androgênica da dihidroxitestosterona (DHT) na proliferação e 

transativação celular, possivelmente através da translocação promovida de receptor de 

andrógeno (AR) para o núcleo [63]. 
 

1.3 A próstata 

 

 A próstata é uma glândula acessória do sistema genital masculino, encontrada somente 

em mamíferos, cuja função é produzir a maior fração do fluido seminal, juntamente com a 

vesícula seminal, promovendo a manutenção do gradiente iônico e pH adequados nessa 

secreção [64,65]. Em humanos, a próstata tem uma morfologia compacta e sem lobos distintos, 

pesa entre 30g e 50g e situa-se inferiormente a bexiga urinária, envolvendo a parte prostática 

da uretra. A próstata humana apresenta-se diferenciada em três zonas: central, de transição e 



16 
 

periférica [66-68]. Em ratos e camundongos, a glândula é composta por quatro lobos distintos: 

anterior ou glândula coaguladora, dorsal, lateral e ventral [69]. Os lobos dispõem-se ao redor 

da base da bexiga, exibindo particularidades quanto à ramificação de ductos e produção de 

secreções proteicas [70-72] (Figura 3).  

 

Figura 3: Representação esquemática da próstata de roedor e de humano. (a) Vista anterolateral 

da próstata de um roedor, com os lobos ventral, lateral, dorsal e anterior dispostos 

circunferencialmente ao redor da uretra. (b) Vista sagital da próstata humana, com as zonas de 

transição, periférica e central apontadas. Adaptado de Shappell et al. (2004) e Peng & Joyner 

(2015). 

 De acordo com Peehl e colaboradores [73] o epitélio prostático é composto por cinco 

tipos celulares com suas respectivas funções. Células epiteliais secretoras, que revestem o 

lúmen dos ácinos prostáticos, expressam altos níveis de receptores de andrógenos (ARs) e são 

responsáveis pela produção e secreção do líquido prostático; células epiteliais basais, as quais 

formam uma monocamada sobre a membrana basal, envolvendo o epitélio prostático e 

constituem a principal população de células proliferativas do epitélio da próstata; células 

neuroendócrinas, que aparecem em menor quantidade e secretam uma variedade de fatores de 

crescimento que, possivelmente, afetam o desenvolvimento e a manutenção do tecido 

prostático; “stem cells” que mesmo raras parecem localizar-se na camada de células basais; e, 

por último, células transitórias amplificadoras, as quais expressam características entre as 

células basais e secretoras e podem ser células progenitoras ainda não diferenciadas [73].  

 Entremeando as estruturas glandulares epiteliais há um estroma conjuntivo ricamente 

vascularizado, com células musculares lisas dispostas concentricamente aos ácinos e 

entremeadas às camadas de colágeno, bem como fibras conjuntivas e elásticas [74]. As células 

musculares lisas exercem papel contrátil durante a ejaculação e juntamente com os fibroblastos 

são responsáveis pela síntese dos componentes da matriz extracelular. Entre os elementos 

estruturais que integram a matriz, destacam-se as fibras colágenas, reticulares e elásticas, as 

quais conferem resistência mecânica e flexibilidade ao tecido, servindo como substrato para a 

ancoragem e migração celular [75,76]. As células estromais são responsáveis por direcionar os 

a b 



17 
 

processos de desenvolvimento, manutenção e diferenciação do epitélio, fornecendo nutrientes 

e fatores de crescimento [77]. 

 O desenvolvimento da próstata inicia-se na parte pélvica do seio urogenital, e é 

estimulada pela secreção de andrógenos nos testículos fetais [78-80]. Esta ação dos andrógenos 

é mediada por receptores de andrógenos (ARs), que são ativados pela interação com a 

testosterona ou dihidrotestosterona (DHT) [64]. Shima et al. [81] relacionaram a ação da 

testosterona a uma resposta de fatores androgênicos que regulam a proliferação das células 

epiteliais. Além disso, o crescimento e desenvolvimento do epitélio prostático e a morfogênese 

estromal são dependentes da interação epitélio-mesenquimal mediada e regulada por 

andrógenos e fatores de crescimento, tais como IGF, FGF e EGF [82-84].  

 A literatura descreve que, pouco antes da puberdade, ocorre uma cascata de sinalização 

celular para retomar o desenvolvimento e amadurecimento da próstata. Com base neste 

conhecimento, sabemos que a formação que se inicia ainda no período embrionário, diminui 

durante um determinado tempo e é retomada na pré-puberdade [85-87]. Esse fator é 

especialmente interessante, porque não estando totalmente maduro em relação a sua morfologia 

e fisiologia, a próstata pode sofrer ação de fatores externos em qualquer uma de suas fases de 

desenvolvimento. Perobelli [88] relatou que o período pré-púbere, período de organogênese 

tardia da próstata, pode tornar o órgão mais sensível a agentes tóxicos.  

Para além de distúrbio no sistema hormonal, a exposição a agentes tóxicos durante a 

fase de desenvolvimento e amadurecimento (pré-puberdade) da criança, fase onde ocorre o 

aumento dos hormônios responsáveis por estimularem o crescimento e amadurecimento dos 

orgãos sexuais, mudanças de comportamento e início da produção de células germinativas [88], 

pode resultar em algumas consequências que poderão refletir na vida adulta [89,90]. Estudos 

descreveram a influência dos agentes tóxicos tanto no crescimento acelerado como no 

retardamento do crescimento corporal [91], em alterações na composição dos tecidos, 

problemas na fertilidade, eventos que resultaram em prejuízo na síntese de testosterona, e 

alteração no tempo da instalação da puberdade, causando interferência na  maturação dos órgãos 

sexuais em machos e fêmeas imaturos [88-91]. 

Estudos revelaram que o desenvolvimento de algumas afecções, como é o caso do CaP, 

está relacionado com o estilo de vida ao qual os indivíduos estão expostos, além de fatores 

ambientais, incluindo o aumento da exposição a agentes toxicos amplamente dispersos [92,93]. 

O câncer prostático é o quinto mais prevalente do mundo considerando ambos os sexos, e o 

segundo em indivíduos do sexo masculino, tornando-se atualmente, a segunda maior causa de 

óbito por câncer em homens [94,95]. A agências de controle como a Sociedade Americana de 



18 
 

Câncer e Associação Urológica Americana recomendam fortemente que se façam exames 

preventivos para diagnóstico precoce da doença a partir dos 50 anos de idade, isso porque o 

número de casos da doença tem aumentado de maneira significativa em quase todos os países 

e a taxa de mortalidade tende a aumentar quando o diagnóstico é feito tardiamente [96]. 

A suscetibilidade genética e epigenética, exposição a fatores ambientais, e fatores 

endócrinos podem contribuir para o desenvolvimento do câncer de próstata [97-99]. Ainda, 

neste contexto, o fato de mais de um indivíduo da mesma família e da mesma geração ser 

diagnosticado com a doença, sem histórico familiar, chama a atenção para a possível relação 

com o estilo de vida a que esses individuos estão expostos. De acordo com Gronberg [98], em 

sua revisão sobre a epidemiologia do câncer de próstata, foi realizado um estudo para avaliar o 

grau de influência dos fatores genéticos e ambientais no desenvolvimento do câncer em gêmeos 

monozigóticos e dizigóticos. Os achados desse estudo mostraram que os genes são herdados, 

mas o ambiente aos quais ambos os indivíduos foram submetidos durante suas vidas pode sim 

influenciar na ocorrência da doença [100].   

Estudos com foco na próstata surgiram devido ao aumento crescente da incidência de 

afecções que acometem esse órgão durante o desenvolvimento e, principalmente durante o 

envelhecimento dos indivíduos [68,101,102]. Sabemos que conforme ocorre o envelhecimento, 

os tecidos se tornam mais vulneráveis [103]. Esse processo além de culminar na atrofia 

glandular da próstata, torna o órgão mais sensível aos agentes ambientais, o que faz da próstata 

um interessante modelo para o estudo do processo oncogênico relacionado ao desenvolvimento 

e à epigenética. 

2. JUSTIFICATIVA E RELEVÂNCIA DO TEMA 

 A próstata, uma glândula de importância ímpar no sistema genital masculino, quando 

exposta a agentes tóxicos, sobretudo aqueles que apresentam atividade desreguladora 

endócrina, apresenta grande sensibilidade, modificando sua histofisiologia e, por vezes, 

apresentando respostas adaptativas e/ou carcinogênicas. Diante deste cenário, a literatura tem 

discutido com frequência o aumento da obesidade, por meio da ingestão de dietas ricas em 

gorduras e carboidratos, como problema de saúde pública mundial, tendo sido indicada como 

um dos fatores de predisposição ao câncer de próstata. Adicionalmente, o uso de produtos 

químicos com a finalidade de dirimir problemas na produção agrícola e na manutenção de 

espécies vegetais domésticas, com atividade de interferência endócrina, tem preocupado o 

mundo científico, principalmente pela sua ampla dispersão ambiental. O 2,4-D, além de estar 

associado com outros defensivos agrícolas, é utilizado numa escala anual de 400 mil toneladas 



19 
 

nos EUA, incluindo sua dispersão no ambiente doméstico que ocupa o primeiro lugar.  

 Os estudos que relacionam o sistema genital masculino com a DO e a exposição ao 

2,4-D são escassos e não avaliam profundamente o microambiente prostático. Tendo em vista 

que a próstata adulta é o resultado de eventos morfogênicos que ocorrem nos períodos pré e 

pós-natal, com especial importância para o crescimento e maturação do órgão no período pré-

púbere, mostrou-se importante o estudo dos reflexos da influência destes estressores na 

exposição prolongada, incluindo este período. Além disso, dentre os principais fatores 

etiológicos envolvidos na tumorigênese da próstata estão as alterações a resposta hormonal, a 

inflamação e o estresse oxidativo, respostas provocadas pelas condições reunidas neste 

trabalho, como o excesso de depósitos de gordura, a síndrome metabólica e a exposição aos 

DEs [68].  

3. OBJETIVO 

 O objetivo deste estudo foi avaliar se a DO, associada à exposição ambientalmente 

relevante ao 2,4-D, pode modular o microambiente prostático e causar alterações estruturais e 

moleculares após exposição prolongada desde a pré-puberdade até a idade adulta. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



20 
 

4. REFERÊNCIAS 
 

[1] Cordain, L, et al. Origins and evolution of the Western diet: health implications for the 21st century. 

Am J Clin Nutr, v. 81, n. 2, p. 341–354, 2005. 

[2] Carrera-Bastos. P; Fontes; O’Keefe; Lindeberg; Cordain. The western diet and lifestyle and diseases 

of civilization. Res. Reports Clin. Cardiol, v. 2, p. 15–35, 2011. 

[3] CDC- Centers for Disease Control and Prevention. Fast Food Consumption Among Adults in the 

United States, 2013–2016. NCHS Data Brief. No. 322. October 2018. Disponível em: 

https://www.cdc.gov/nchs/data/databriefs/db322-h.pdf. 

[4] Janssen, H, G. et al. Determinants of takeaway and fast food consumption: a narrative review. Nutr. 

Res. Rev, p. 1–19, 2017. 

[5] Wartella EA, Lichtenstein AH, Boon CS. Comitê do Instituto de Medicina (EUA) sobre o exame 

dos sistemas e símbolos de classificação nutricional na frente da embalagem. Sistemas e símbolos de 

classificação nutricional na frente da embalagem: Relatório da Fase I. Washington (DC): National 

Academies Press (EUA); pág 4, 2010. 

[6] Rakhra, V.; et al. Obesity and the Western Diet: How We Got Here. Mo. Med, v. 117, p. 536–538, 

2020. 

[7] Kumar R, Litoff EJ, Boswell WT, Baldwin WS. High fat diet induced obesity is mitigated in Cyp3a-

null female mice. Chem Biol Interact. 2018; 289:129-40. 

[8] Neto LA. Texeira LA. De doença da civilização a problema de saúde pública: câncer, sociedade e 

medicina brasileira no século XX. Boletim do Museu Paraense Emílio Goeldi. Ciências Humanas, v. 

12, n. 1, p. 173-188, jan.-abr. 2017. DOI: http://dx.doi.org/10.1590/1981.812220 17000100010. 

[9] Azize RL, Gama BK. “Doenças da civilização: você pode curá-las?”:representações sobre cidade, 

natureza e saúde entre classes médias urbanas. Argumentos, vol. 16, n.1, jan./jun. 2019. Departamento 

de Ciências Sociais, Unimontes-MG. https://doi.org/10.32887/issn.2527-2551v16n1p.30-49. 

[10] Greenway, F. L., and Smith SR, The future of obesity research: Nutrition, v. 16, p. 976-82, 2000. 

[11] Yener Y, Yerlikaya FH. Western diet induces endogen oxidative deoxyribonucleic acid damage 

and infl ammation in Wistar rats. Rev Nutr. 2018; 31(3):263-73. http://dx.doi.org/10.1590/1678-

98652018000300001. 

[12] Organização Pan-Americana da Saúde (OPAS). Dia Mundial da Obesidade 2022: acelerar ação 

para acabar com a obesidade. Março 2022. Disponivel em: https://www.paho.org/pt/noticias/4-3-2022-

dia-mundial-da-obesidade-2022-acelerar-acao-para-acabarcomobesidade#:~:text=4%20de%20 

mar%C3%A7o%20de%202022,Esse%20n%C3%BAmero%20continua%20aumentando. 

[13] National Health and Nutrition Examination Survey (NHANES), 2021. Adult Obesity Facts. Dados 

disponíveis em CDC - Centers for Disease Control and Prevention. 

https://www.cdc.gov/obesity/data/adult.html. 

[14] Associação Brasileira para o Estudo da Obesidade e da Síndrome Metabólica (ABESO). Mapa da 

Obesidade, 2019. Disponível em: https://abeso.org.br/obesidade-e-sindrome-metabolica/mapa-da-

obesidade/. 

[15] Chavarro, J. E, et al. Body mass index in relation to semen quality, sperm DNA integrity, and serum 

reproductive hormone levels among men attending an infertility clinic. Fertil. Steril, v. 93, p. 2222–

2231, 2010. 

[16] Jensen, T. K, et al. High dietary intake of saturated fat is associated with reduced semen quality 

among 701 young Danish men from the general population. Am. J. Clin. Nutr, v. 97, p. 411–418, 2013. 

https://www.cdc.gov/nchs/data/databriefs/db322-h.pdf
http://dx.doi.org/10.1590/1981.812220%2017000100010
https://doi.org/10.32887/issn.2527-2551v16n1p.30-49
https://www.paho.org/pt/noticias/4-3-2022-dia-mundial-da-obesidade-2022-acelerar-acao-para-acabarcomobesidade#:~:text=4%20de%20
https://www.paho.org/pt/noticias/4-3-2022-dia-mundial-da-obesidade-2022-acelerar-acao-para-acabarcomobesidade#:~:text=4%20de%20
https://www.cdc.gov/obesity/data/adult.html
https://abeso.org.br/obesidade-e-sindrome-metabolica/mapa-da-obesidade/
https://abeso.org.br/obesidade-e-sindrome-metabolica/mapa-da-obesidade/


21 
 

[17] Fan, Y, et al. Diet-induced obesity in male C57BL/6 mice decreases fertility as a consequence of 

disrupted blood-testis barrier. PLoS One, v. 10, p. 1–15, 2015. 

[18] Jarvis,  S,  et al. High fat diet causes distinct aberrations in the testicular proteome. Int. J. Obes, v. 

44, p. 1958–1969, 2020. 

[19] Snowdon, D. A.; Phillips, R. L.; Choi, W. Diet, obesity, and risk of fatal prostate cancer. American 

Journal of Epidemiology, v. 120, n. 2, p. 244–250, 1984. 

[20] Talamini, R. et al. Nutrition, social factors and prostatic cancer in a northern italian population. 

British Journal of Cancer, v. 53, n. 6, p. 817–821, 1986.  

[21] Stacewicz-Sapuntzakis, M. et al. Correlations of dietary patterns with prostate healthMolecular 

Nutrition and Food ResearchMol Nutr Food Res, , 2008. Disponível em: 

<https://pubmed.ncbi.nlm.nih.gov/18080240/>. Acesso em: 26 out. 2021 

[22] Schulz, W. A.; Burchardt, M.; Cronauer, M. V. Molecular biology of prostate cancer. Mol. Hum. 

Reprod, v. 9, p. 437–448, 2003. 

[23] Vikram, A.; Jena, G. B.; Ramarao, P. Increased cell proliferation and contractility of prostate in 

insulin resistant rats: Linking hyperinsulinemia with benign prostate hyperplasia. Prostate v. 70, p. 79–

89, 2010. 

[24] Shankar. E, et al. High-fat diet activates pro-inflammatory response in the prostate through 

association of Stat-3 and NF-κB. The Prostate, v. 72, p. 233–243, 2012. 

[25] Hayashi, T. et al. High-fat diet-induced inflammation accelerates prostate cancer growth via IL6 

signaling. Clinical Cancer Research, v. 24, n. 17, p. 4309–4318, 2018. 

[26] Li. Y, et al. Effects of inflammatory responses, apoptosis, and STAT3/NF-κB- and Nrf2-mediated 

oxidative stress on benign prostatic hyperplasia induced by a high-fat diet. Aging, v. 11, p. 5570-5578, 

2019. 

[27] Dutra, R. M. S., & Souza, M. M. O. D. (2022). Cerrado, Revolução Verde e evolução do consumo 

de agrotóxicos. Sociedade & Natureza, 29, 473-488. 

[28] Food and Agriculture Organization of the United Nations (FAO). Pesticides Use. Last Update July 

15, 2022. Accessed May 30, 2023. Disponível em: https://www.fao.org/faostat/en/#data/RP/visualize. 

[29] Van Bruggen, A. H. C, et al. Environmental and health effects of the herbicide glyphosate. Sci 

Total Environ, v. 616, n. 617, p. 255–268, 2018. 

[30] Carneiro, F. F. et al. Segurança Alimentar e nutricional e saúde. Parte 1. In CARNEIRO, Fernando 

Ferreira et al. (org.) Dossiê ABRASCO: um alerta sobre os impactos dos agrotóxicos na saúde. Rio de 

Janeiro: EPSJV; São Paulo: Expressão Popular, 2015. Disponível em: Acesso: 15 ago. 2017. 

[31] Benatto, A. Sistemas de informação em saúde nas intoxicações por agrotóxicos e afins no Brasil: 

Situação atual e pespectivas, 2002. 

[32] WHO - World Health Organization. Poison prevention and Management. International Programme 

on Chemical: 2012 [cited 2020 Jan 9]. Available from: http://www.who.int/ipcs/poisons/en/. 

[33] Carazo-Rojas, E., Pérez-Rojas, G., Pérez-Villanueva, M., Chinchilla-Soto, C., Chin-Pampillo, JS, 

Aguilar-Mora, P., & Vryzas, Z. (2018). Monitoramento de agrotóxicos e avaliação de risco 

ecotoxicológico em corpos d'água superficiais e sedimentos de um agroecossistema tropical. Poluição 

ambiental, 241, 800-809. 

[34] CDC - Centers for Disease Control and Prevention. Fourth National Report on Human Exposure to 

Environmental Chemicals. Atlanta (GA), p. v., 2009. 

 

https://www.fao.org/faostat/en/#data/RP/visualize
http://www.who.int/ipcs/poisons/en/


22 
 

[35] Carson, R. Primavera_Silenciosa. Melhoramentos, 2010. Disponível em: 

http://www.rbma.org.br/mab/unesco_01_oprograma.asp. 

[36] Gomes F. G.; Christoffoleti, P. J. Biologia e manejo de plantas daninhas em áreas de plantio direto. 

Planta Daninha, v. 26, n. 4, p. 789–798, 2008.  

[37] Lopes, C. V. A.; Albuquerque, G. S. C. DE. Agrotóxicos e seus impactos na saúde humana e 

ambiental: uma revisão sistemática. Saúde em Debate, v. 42, n. 117, p. 518–534, 2018.  

[38] IBAMA. Ranking dos Agrotóxicos. Boletim 2020. Disponível em: https://www.gov.br/pt-br. 

Acesso em: 27 fevereiro 2023. 

[39] National Library of Medicine (EUA), National Center for Biotechnology Information; 2004-. 

PubChem Compound Summary para CID 1486, ácido 2,4-diclorofenoxiacético; [citado em 28 de maio 

de 2023]. Disponível em: https://pubchem.ncbi.nlm.nih.gov/compound/2_4-Dichlorophenoxyacetic-

acid. 

[40] Peterson, M. A, et al. 2,4- D Past, Present, and Future: A Review. Weed Technol, v. 30, n. 2, p. 

303– 45, 2016. 

[41] Islam, F, et al. Potential impact of the herbicide 2,4-dichlorophenoxyacetic acid on human and 

ecosystems. Environ Int. v. 111, p. 332–51, 2018. 

[42] AGROFIT, 2022. Relatório de ingredientes ativos. Disponível em: < https://agrofit.agricultura. 

gov.br/agrofit_cons/principal_agrofit_cons>. Acesso em: 13 out 2022. 

[43] Roman, E. S. et al. Como Funcionam Os Herbicidas: da biologia à aplicação. Gráfica Editora 

Berthier, p. 1–152, 2005. 

[44] Carvalho, L. B. D. E. Herbicidas, 1. ed. Lages/SC. 2013. 

[45] Song. Y. Insight into the mode of action of 2,4-dichlorophenoxyacetic acid (2,4-D) as an herbicide. 

J Integr Plant Biol, v. 56, n. 2, p. 106–130, 2014. 

[46] Von Stackelberg, K. A systematic review of carcinogenic outcomes and potential mechanisms from 

exposure to 2,4-D and MCPA in the environment. Journal of Toxicology, v. 2013. 

[47] Osipe, J. B, et al. Espectro de controle de plantas daninhas com os herbicidas 2,4-D e dicamba 

associados ou não ao glyphosate. Planta Daninha, v. 35, 2017. 

[48] Walters, J. Environmental fate of 2,4-dichlorophenoxyacetic acid. Environ. Monit. Pest Manag, p. 

1-18, 2011. 

[49] ANVISA. RESOLUÇÃO-RDC nº 347, de 16 de dezembro de 2002. disponível em: 

https://bvsms.saude.gov.br/bvs/saudelegis/anvisa/2002/rdc0347_16_12_2002.html. 

[50] European Food Safety Authority. Conclusion on the peer review of the pesticide risk assessment of 

the active substance 2,4-D. EFSA; 2017. Accessed March 7, 2023. 

https://efsa.onlinelibrary.wiley.com/doi/epdf/10.2903/j.efsa.2014.3812. 

[51] FAO. FAO/WHO Meeting on pesticide residues: 2018 [cited 2020 Jan 9]. Available from: 

http://www.fao.org/fao-who-codexalimentarius/shproxy/es/?lnk=1&url=https%253A%252F%252Fwo 

kspace.fao.org%252Fsites%252Fcodex%252FCircular%252520Letters%252FCL%252520201811%2

52Fcl18_11e.pdf. 

[52] ANVISA. Divulgado relatório sobre resíduos de agrotóxicos em alimentos, 2016 [cited 2020 Jan 

9]. Available from: http://portal.anvisa.gov.br/noticias/asset_publisher/FXrpx9qY7FbU/content/ 

divulgado-relatorio-sobre- residuos-de-agrotoxicos-em-alimentos/219201?inheritRedirect=false. 

 

 

http://www.rbma.org.br/mab/unesco_01_oprograma.asp
https://agrofit.agricultura/
https://efsa.onlinelibrary.wiley.com/doi/epdf/10.2903/j.efsa.2014.3812


23 
 

[53] ANVISA. Reavaliação Toxicológica: Agrotóxico 2,4-D passa a ter restrições na aplicação, 2019. 

[cited 2022 Dez 20]. https://www.gov.br/anvisa/pt-br/assuntos/noticias-anvisa/2019/agrotoxico-24-d-

passa-a-ter-restricoes-na-aplicacao. 

[54] Gallagher, E. P.; Di Giulio, R. T. Effects of 2, 4-dichlorophenoxyacetic acid and picloram on 

biotransformation, peroxisomal and serum enzyme activities in channel catfish (Ictalurus punctatus). 

Toxicology Letters, v. 57, n. 1, p. 65–72, 1 jun. 1991.  

[55] Friedrich, K. Avaliação Dos Efeitos Tóxicos Sobre O Sistema Reprodutivo, Hormonal E Câncer 

Para Seres Humanos Após O Uso Do Herbicida 2,4-D. Fundação Oswaldo Cruz, n. 21, p. 1–45, 2014.  

[56] ANVISA. Monografia 2,4-D, 2014. Disponível em:http://portal.anvisa.gov.br/wps/wcm/connect/ 

bdea3b804745780e857bd53fbc4c6735/D27++24 D.pdf?MOD=AJPERES. Acesso em: 01/03/2014 

[57] IARC, I. A. FOR R. ON C. EVALUATION OF CARCINOGENIC RISKS OveraIl Evaluations of 

Carcinogenicity : IARC Monographs, v. 1–42, 1987.  

[58] Venkov, P. et al. Genotoxic effect of substituted phenoxyacetic acids. Archives of Toxicology 2000 

74:9, v. 74, n. 9, p. 560–566, 2000.  

[59] Amer, S. M.; ALY, F. Genotoxic effect of 2,4-dichlorophenoxy acetic acid and its metabolite 2,4-

dichlorophenol in mouse. Mutation research, v. 494, n. 1–2, p. 1–12, 2001.  

[60] Marouani, N. et al. Effects of oral administration of 2,4-dichlorophenoxyacetic acid (2,4-D) on 

reproductive parameters in male Wistar rats. Environmental Science and Pollution Research, v. 24, n. 

1, p. 519–526, 2017.  

[61] Kim HJ, Kim WD, Kwon TH, et al. (2002). Mecanismo de compostos fenoxi como um desregulador 

endócrino. J Toxicol Pub Health 18: 331 – 339.  

[62] Pochettino, A. A. et al. Oxidative stress in ventral prostate, ovary, and breast by 2,4-

dichlorophenoxyacetic acid in pre- and postnatal exposed rats. Environmental Toxicology, v. 28, n. 1, 

p. 1–10, 1 jan. 2013. 

[63] Kim, H.-J.; Park, Y. I.; Dong, M.-S. Effects of 2,4-D and DCP on the DHT-Induced Androgenic 

Action in Human Prostate Cancer Cells. Toxicological Sciences, v. 88, n. 1, p. 52–59, 1 nov. 2005.  

[64] Marker, P. C. et al. Hormonal cellular and molecular control of prostatic development. 

Developmental Biology, v. 253, n. 2, p. 165–174, 15 jan. 2003.  

[65] Untergasser, G.; Madersbacher, S.; Berger, P. Benign prostatic hyperplasia: Age-related tissue-

remodelingExperimental Gerontology Exp Gerontol, , 2005. Disponível em: 

<https://pubmed.ncbi.nlm.nih.gov/15763388/>. Acesso em: 1 nov. 2021. 

[66] Mcneal, J. E. The prostate gland, morphology and pathobiology. In: Monographs in urology. 4, 3-

37; 1983.  

[67] Roy-Burman, P. et al. Genetically defined mouse models that mimic natural aspects of human 

prostate cancer developmentEndocrine-Related CancerEndocr Relat Cancer, , jun. 2004. Disponível em: 

<https://pubmed.ncbi.nlm.nih.gov/15163300/>. Acesso em: 1 nov. 2021. 

[68] De Marzo, A. M. et al. Inflammation in prostate carcinogenesisNature Reviews CancerNat Rev 

Cancer, , abr. 2007. Disponível em: <https://pubmed.ncbi.nlm.nih.gov/17384581/>. Acesso em: 1 nov. 

2021 

[69] Shirai, T. et al. Experimental prostate carcinogenesis - Rodent models. Mutation Research - 

Reviews in Mutation Research, v. 462, n. 2–3, p. 219–226, 2000.  

[70] Sugimura, Y.; Cunha, G. R.; Donjacour, A. A. Morphogenesis of ductal networks in the mouse 

prostate. Biology of reproduction, v. 34, n. 5, p. 961–971, 1986.  

https://www.gov.br/anvisa/pt-br/assuntos/noticias-anvisa/2019/agrotoxico-24-d-passa-a-ter-restricoes-na-aplicacao
https://www.gov.br/anvisa/pt-br/assuntos/noticias-anvisa/2019/agrotoxico-24-d-passa-a-ter-restricoes-na-aplicacao


24 
 

[71] SHAPPELL S.B, et al. Prostate pathology of genetically engineered mice: definitions and 

classification. The consensus report from the Bar Harbor meeting of the Mouse Models of Human 

Cancer Consortium Prostate Pathology Committee. Cancer Res. 64:2270–2305, 2004. 

[72] Peng YC & Joyner AL. Hedgehog signaling in prostate epithelial-mesenchymal growth regulation. 

Dev Biol, 1:94-104, 2015. 

[73] Peehl, D. M. Primary cell cultures as models of prostate cancer developmentEndocrine-Related 

CancerEndocr Relat Cancer, mar. 2005. Disponível em: <https://pubmed.ncbi.nlm.nih.gov/15788637/>. 

Acesso em: 1 nov. 2021. 

[74] Carvalho, H. F.; Line, S. R. P. Basement membrane associated changes in the rat ventral prostate 

following castration. Cell Biology International, v. 20, n. 12, p. 809–819, 1996.  

[75] Tuxhorn, J. A.; Ayala, G. E.; Rowley, D. R. Reactive stroma in prostate cancer progressionJournal 

of Urology, 2001.  

[76] Vilamaior, P. S. L.; Taboga, S. R.; Carvalho, H. F. Modulation of smooth muscle cell function: 

Morphological evidence for a contractile to synthetic transition in the rat ventral prostate after castration. 

Cell Biology International, v. 29, n. 9, p. 809–816, 2005.  

[77] Berry, P. A.; Maitland, N. J.; Collins, A. T. Androgen receptor signalling in prostate: Effects of 

stromal factors on normal and cancer stem cells. Molecular and Cellular Endocrinology, v. 288, n. 1–2, 

p. 30–37, 2008.  

[78] Price, D. Comparative aspects of development and structure in the prostate. National Cancer 

Institute Monograph, p. 1–27, 1963.  

[79] Pointis, G.; Latreille, M. T.; Cedard, L. Gonado-pituitary relationships in the fetal mouse at various 

times during sexual differentiation. J Endocrinol, v. 86, p. 483–488, 1980.  

[80] Cunha, G. R. et al. The endocrinology and developmental biology of the prostate. Endocrine 

Reviews, v. 8, n. 3, p. 338–362, 1987.  

[81] Shima, H. et al. Development of Male Urogenital Epithelia Elicited by Soluble Mesenchymal 

Factors. Journal of Andrology, v. 16, n. 3, p. 233–241, 6 maio 1995. 

[82] Cunha, G. R.; Lang B. Experimental analysis of male accessory sex gland development. In 

Accessory Gmdsof the Male Reproductive Tract. E. Spring-MRlsand E. S. E. Hafez, editors. Elsevier 

North-HoUand, Hew York. 39-59; 1980. 

[83] Cunha, G. R. Prostatic epithelial morphogenesis, growth, and secretory cytodifferentiation are 

elicited via trophic influences from mesenchyme. In: Bresciani F, King RJB, Lipman ME, Namer M, 

Raynaud JP, (eds.).Progress in Cancer Research and Therapy. New York: Raven Press, 31, 121-28; 

1984. 

[84] Hayward. S. W.; Cunha. G. R.; The prostate: development and physiology. Radiol Clin North Am 

38, 1–14; 2000. 

[85] Zhao, C. Y.; Tam, C. C.; Wong, Y. C.; Morphogenesis and ductal development of the prostatic 

complex of the guinea pig.Journal of Morphology, Malden. 217, 219-227; 1993. 

[86] Horsfall, D. J. et al. Agerelated changes in guinea pig prostatic stroma. Laboratory Investigation, 

Augusta. 70(5), 753 - 763; 1994. 

[87] Thomson, A. A. Role of androgens and fibroblast growth factors in prostatic development. 

Reproduction, Bristol. 121, 187- 195; 2001. 

[88] Perobelli, J. E. The male peripubertal phaseas a development alwindowfor reproductive toxicology 

studies. Current pharmaceutical design, 20 (34), 5398-5415; 2014. 



25 
 

[89] Caserta, D, et al. Impact of endocrine disruptor chemicals in gynaecology. Hum. Reprod. Update 

14, 59–72; 2008. 

[90] Mantovani, A.; Fucic, A. Puberty dys regulation and increased risk of disease in adult life: Possible 

mode sofaction. Reprod Toxicol. 44, 15-22 2013. 

[91] Dostal, L. A, et al. Testicular toxicity and reduced Sertoli cell numbers in neonatal ratsbydi(2-

ethylhexyl) phthalate and there covery of fertilityas adults. Toxicology and applied pharmacology, 

95(1), 104-121; 1988. 

[92] Miller, G. J. Prostate cancer among the Chinese: Pathological and epidemiological and nutritional 

considerations. In: Resnick MI, Thompson IM, editors. Advanced therapy of prostate disease. Hamilton, 

Ontario, BC: Decker, Inc. 18–27; 1999. 

[93] De Marzo, A. M, et al. Pathological and molecular mechanisms of prostate carcinogenesis: 

implications for diagnosis, detection, prevention, and treatment. Journal of cellular biochemistry. 91(3), 

459-477; 2004. 

[94] Abouassaly, R et al. Epidemiology, etiology, and prevention of prostate cancer. Campbell-Walsh 

Urology, v. 10, p. 2704-2, 2012 

[95] Darves-Bornoz, A.; Park, J.; Katz, A. Prostate Cancer Epidemiology. In: Prostate Cancer: Diagnosis 

and Clinical Management. Chichester: Wiley Blackwell, 2014. P.1-15. 

[96] Crawford, E. D. Epidemiology of prostate cancer. Urology. 62(6), 3-12; 2003.  

[97] Key, T. J. Hormones and cancer in humans. Mutat Res. 333, 59–67; 1995.  

[98] Gronberg, H. Prostate cancer epidemiology. The Lancet, 361, (9360), 859-864; 2003. 

[99] Benbrahim-Tallaa, L; Waalkes, M. P. Inorganic arsenic and human prostate cancer. Environmental 

health perspectives.116(2),158; 2008. 

[100] Lichtenstein P, et al. Environmental and heritable factor sin the causation of cancer - analyses of 

cohorts of twins from Sweden, Denmark, and Finland. New Englandjournalofmedicine. 343(2), 78-85; 

2000. 

[101] Palapattu, G. S, et al. Prostate specific antigen progression in men with lymph node metastases 

following radical prostate ctomy: results of long-term follow up. The Journal of urology, 172(5), 1860-

1864; 2004. 

[102] Sciarra A, et al. Role of dynamic contrast-enhanced magnetic resonance (MR) imaging and proton 

MR spectroscopic imaging in the detection of local recurrence after radical prostate ctomy for prostate 

cancer. European urology. 54(3), 589-600; 2008. 

[103] Mc Neal, J. E. Ageingandtheprostate. In: Brockle-hurstJC, editor. Urologyin theelderly. 

Edinburgh, UK: Churhill Livingstone. 193–202; 1984. 

 

 

 

 

 

 

 

 



26 
 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

CAPÍTULO II 

 Artigo científico 
 

 

 



Reproductive Toxicology 120 (2023) 108449

Available online 28 July 2023
0890-6238/© 2023 Elsevier Inc. All rights reserved.

2,4-dichlorophenoxyacetic acid (2,4-D) exposure during postnatal 
development alters the effects of western diet on mouse prostate 

V.A. Rocha a, A.M. Aquino a, N. Magosso a, P.V. Souza a, L.A. Justulin a, R.F. Domeniconi a, 
L.F. Barbisan a, G.R. Romualdo a,b, W.R. Scarano a,* 

a São Paulo State University (UNESP), Department of Structural and Functional Biology, Institute of Biosciences, Botucatu, São Paulo, Brazil 
b São Paulo State University (UNESP), Botucatu Medical School, Experimental Research Unit (UNIPEX), Multimodel Drug Screening Platform – Laboratory of 
Chemically induced and Experimental Carcinogenesis (MDSP-LCQE), Botucatu, SP, Brazil   

A R T I C L E  I N F O   

Handling Editor: Dr. Bal-Price Anna  

Keywords: 
Prostate 
Obesity 
Herbicides 
2 
4-D 
Reproductive toxicology 

A B S T R A C T   

Western diet (WD), abundant in saturated fats and simple carbohydrates, has been associated with the devel-
opment of prostate diseases. In addition, 2,4-dichlorophenoxyacetic acid (2,4-D), an herbicide used in agricul-
tural and non-agricultural settings, may interfere with the endocrine system impacting reproductive health. The 
association of both factors is something common in everyday life, however, there are no relevant studies asso-
ciating them as possible modulators of prostatic diseases. This study evaluated the action of the herbicide 2,4-D 
on the postnatal development of the prostate in mice fed with WD. Male C57Bl/6J mice received simultaneously 
a WD and 2,4-D at doses of 0.02, 2.0, or 20.0 mg/kg b.w./day for 6 months. The prolongated WD intake induced 
obesity and glucose intolerance, increasing body weight and fat. WD induced morphological changes and 
increased PCNA-positive epithelial cells in prostate. Additionally, the WD increased gene expression of AR, 
antioxidant targets, inflammation-related cytokines, cell repair and turnover, and targets related to methylation 
and miRNAs biosynthesis compared to the counterpart (basal diet). 2,4-D (0.02 and 2.0) changed prostate 
morphology and gene expression evoked by WD. In contrast, the WD group exposed to 20 mg/kg of 2,4-D 
reduced feed intake and body weight, and increased expression of androgen receptor and genes related to cell 
repair and DNA methylation compared to the negative control. Our results showed that 2,4-D was able to 
modulate the effects caused by WD, mainly at lower doses. However, further studies are needed to elucidate the 
mechanisms of 2,4-D on the obesogenic environment caused by the WD.   

1. Introduction 

Western diet (WD), currently adopted as one of the main occidental 
dietary patterns, is characterized by the excessive intake of calories, 
simple sugar, fat and red meat, and ultra-processed foods [1]. Along 
with the spread of WD style adopted mainly in North America and 
Western Europe, the obesity rate has progressively increased worldwide 
since recent data from the World Health Organization (WHO) indicate 
that more than one billion people worldwide are overweight [2]. In the 
last three generations, especially in developed and developing countries, 

an epidemic of non-infectious diseases caused especially by WD intake 
has been observed. Obesity, type 2 diabetes mellitus (T2DM), metabolic 
syndrome (MS), cardiovascular diseases and cancer are currently among 
the leading causes of death around the world [3–5]. Several animal 
models have been proposed to mimic WD exposure [6–8]. A recent 
study, using the same protocol used in this study, showed that 6 months 
WD intake was able to induce obesity and glucose intolerance in male 
mice [8]. 

2,4-dichlorophenoxyacetic acid (2,4-D, CAS 94–75–7) is a synthetic 
auxin derived from phenoxyacetic acid (9), present in about 1500 

Abbreviations: WD, Western Diet; 2,4-D, 2,4-dichlorophenoxyacetic acid; ED, endocrine disrupting; PCa, Prostate Cancer; Ctrl, Control group; T1, WD + 2,4-D 
(0.02 mg); T2, WD + 2,4-D (2.0 mg); T3, WD + 2,4-D (20.0 mg); VP, Ventral prostate; AR, Androgen Receptor; PCNA, Proliferative Nuclear Cell Antigen; IL10,, 
Interleukin 10; IL6, Interleukin 6; TNF-α, Tumor necrosis factor alpha; SOD, superoxide dismutase; CAT, catalase; GSR, glutathione reductase; GPX3, Glutathione 
Peroxidase 3; CASP3, caspase 3; DNMT1, DNA methyltransferase 1; DICER1, Dicer 1 ribonuclease III; DROSHA, Drosha ribonuclease III. 

* Correspondence to: Department of Structural and Functional Biology Institute of Biosciences – São Paulo State University, UNESP, Botucatu 18618–970, SP, 
Brazil Zip Code . 

E-mail address: wellerson.scarano@unesp.br (W.R. Scarano).  

Contents lists available at ScienceDirect 

Reproductive Toxicology 

journal homepage: www.elsevier.com/locate/reprotox 

https://doi.org/10.1016/j.reprotox.2023.108449 
Received 30 June 2023; Received in revised form 24 July 2023; Accepted 26 July 2023   

mailto:wellerson.scarano@unesp.br
www.sciencedirect.com/science/journal/08906238
https://www.elsevier.com/locate/reprotox
https://doi.org/10.1016/j.reprotox.2023.108449
https://doi.org/10.1016/j.reprotox.2023.108449
https://doi.org/10.1016/j.reprotox.2023.108449
http://crossmark.crossref.org/dialog/?doi=10.1016/j.reprotox.2023.108449&domain=pdf


Reproductive Toxicology 120 (2023) 108449

2

commercial herbicide formulations, becoming one of the most widely 
used pesticides in the world [9,10]. 2,4-D has played an important role 
in modern agriculture, showing high success rates in selective chemical 
control of weeds in crop production [11]. 2,4-D is considered an endo-
crine disruptor (ED), exhibiting harmful effects on the hormonal system 
and impacting the reproductive and general health of exposed in-
dividuals [12,13]. Studies have shown that at high doses (50–200 mg/kg 
b.w. for 30 days), 2,4-D induces increased weight of male reproductive 
organs, significant morphological changes in prostate parenchyma, and 
increased androgen receptor expression [14,15]. 

WD chronic intake associated with obesity, T2DM, MS and others 
comorbidities has been related to pathological changes in the male 
reproductive system. Several studies have shown that WD consumption 
induces a pro-inflammatory and pro-oxidant microenvironment, in 
which chronic prostatic diseases are likely to develop, such as benign 
prostatic hyperplasia (BPH) and prostate cancer (PCa) [16–18]. In 
addition, WD consumption has been related to increased prostate pro-
liferation, and positive modulation of inflammatory mediators in the 
prostate [19,20]. Over the years, many works have presented obesity as 
a risk factor for PCa, studies that evaluated this parameter indicated that 
overweight men have a significantly higher risk of developing PCa [18, 
21,22]. 

The prostate is an accessory gland of the male genital system 
responsible for producing the largest fraction of the seminal fluid, pro-
moting the maintenance of the proper ionic gradient and pH in this 
secretion [20,23]. The development of the prostate begins in the pelvic 
part of the urogenital sinus, and is stimulated by the secretion of an-
drogens in the testes of the human fetus and in rodents [24–26]. The 
literature has described that just before puberty a cellular signaling 
cascade occurs to induce prostate development and maturation [27–29]. 
The prepubertal period, a period of late organogenesis of the prostate, 
can make the organ more sensitive to toxic agents and result in some 
consequences that may reflect in adulthood and senescence [30–32]. 

Studies relating the male genital system to WD and 2,4-D exposure 
are scarce and do not thoroughly evaluate the prostate microenviron-
ment. Taking into consideration that the adult prostate is the result of 
morphogenic events that occur in the prenatal and postnatal periods, 
with special importance for the growth and maturation of the organ in 
the prepubertal period, it is necessary to study the reflexes of the in-
fluence of stressors on prolonged exposure including this period. 
Moreover, among the main etiological factors involved in prostate 
tumorigenesis are the hormonal changes, inflammation and systemic 
oxidative stress, responses caused by the conditions gathered in this 
work, such as excess fat deposits, metabolic syndrome and exposure to 
EDs [33]. Thus, the aim of this study was to evaluate whether an envi-
ronmentally relevant 2,4-D exposure associated with WD consumption 
can modulate the prostate microenvironment and cause structural and 
molecular changes upon prolonged exposure from the prepuberty to 
adulthood. 

2. Material and methods 

2.1. Animals 

The animals were purchased from the Multidisciplinary Center for 
Biological Research (CEMIB-UNICAMP, Campinas-SP, Brazil) and kept 
in the Experimental Research Unit (UNIPEX) – Botucatu Medical School, 
São Paulo State University (FMB -UNESP, Botucatu). During the exper-
imentation phase, the animal housing conditions were controlled: tem-
perature (22 ± 2 ºC), relative humidity (55 ± 10 %), light period (12 h 
light/12 h dark), and continuous air exhaustion. The proposal followed 
the ARRIVE (Animal Research: Reporting of In Vivo Experiments) 
guidelines [34] and the regulations established by the National Council 
for the Control of Animal Experimentation (CONCEA, Brazil). Addi-
tionally, the experimental procedures were approved by the Ethics 
Committee on the Use of Animals (CEUA - IBB/UNESP no 5897260423). 

2.2. Experimental design 

Six-week-old male C57BL/6J mice (~PND35) were randomly 
assigned to five experimental groups (n = 10 animals/group). The 
control group (Ctrl) received AIN-93 G chow and filtered water ad 
libitum for six months [35]. The other groups (WD; T1-T3) were sub-
jected to the Western diet model, receiving a high fat and sugar [30 % 
lard and 0.02 % cholesterol, corresponding to ~56 % of calories and rich 
in sucrose (20 %), Pragsoluç ões Biociências, Brazil] and a solution rich 
in sugars (HSS; 23.1 and 18.9 g/L of D-fructose and D-glucose) 
(Dinâmica, Brazil) in drinking water ad libitum for 6 months [8]. 
Furthermore, during the same period, the animals received 2,4-D 
(D7299, Sigma-Aldrich, USA) by gavage (5 times/week), diluted in ul-
trapure distilled water (Invitrogen, USA), at doses of (T1) 0.02; (T2) 2.0 
corresponding to the European ADI and NOAEL, respectively, and (T3) 
20.0 mg/kg bw/day, a lower dose than those used in medium-term ex-
periments with some adverse effect on the male genital system [14,15, 
36]. The lowest dose is also close to the estimated range of human 
environmental exposure, in micrograms [37]. Ctrl and WD groups 
received only the 2,4-D vehicle (ultrapure water). 

After 6 months (~PND215), the animals were fasted for 12 h, 
weighed, and euthanized by exsanguination under anesthesia (keta-
mine/xylazine solution at 100/16 mg/kg b.w. intraperitoneal). During 
necropsy, the ventral prostate and adipose tissues (epididymal, mesen-
teric, retroperitoneal, and subcutaneous fats) were removed and 
weighed. Ventral prostate (VP) fragment samples were assigned for 
analysis. 

2.3. Biometrics parameters 

The initial and final body mass (after the experimental period) of all 
animals was recorded (n = 10/group). The food consumption was 
recorded once a week during the experimental period and the average 
chow consumption per animal was calculated. The VP and adipose tis-
sues were collected and subsequently weighed, and VP absolute weight 
and absolute and relative fat weights were calculated. 

2.4. Glucose tolerance test (GTT) 

Five days before euthanasia, after 12 h fasting, mice (n = 6 animals/ 
groups) received 2 g/kg b.w. of glucose intraperitoneally. Blood glucose 
was measured after 30, 60, 90 and 120 min using an automated gluc-
ometer (Accu-check Active monitor, Roche, Germany). Glucose level 
curves were calculated, as well as the area under the curve (AUC). 

2.5. Light microscopy 

VP fragments (n = 5 animals/group) were fixed by immersion in 
Methacarn for 4 h (Puchtler et al., 1970). After fixation, the material was 
dehydrated in an increasing series of ethanol, diaphanized in xylol, and 
included in Paraplast Plus® (Sigma-Aldrich, USA). Semi-serial histo-
logical sections were sectioned 5 µm thick (with a 50 µm interval be-
tween sections) on a rotating microtome and subsequently collected on 
silanized slides and stored until the time of use. Histological sections 
were stained with hematoxylin-eosin (H&E) for morphological analysis, 
picrosirius red to highlight collagen fibers, and toluidine blue to analyze 
mast cells. The VP sections were analyzed and the microscopic fields 
were digitized using an image analysis system (Image-Pro-Plus software 
version 4.5 for Windows) connected to a Leica DM 2500 microscope. 

2.6. Stereological analysis 

VP sections stained with H&E were analyzed to measure the relative 
proportion of the tissue components: epithelium, lumen and stroma 
compartments, based on the Weibel score system which consists of a test 
system of lines and points in a with 168 points [38]. Ten digitalized 

V.A. Rocha et al.                                                                                                                                                                                                                                



Reproductive Toxicology 120 (2023) 108449

3

histological fields (×200) were taken randomly from histological sec-
tions (n = 5 animals/group; 50 images/group). 

2.7. Relative volume of collagen 

Histological sections stained by picrosirius red were analyzed to 
measure the relative volume of collagen in the prostate. Five random-
ized histological fields (x200) from two different depths of VP fragment 
(n = 50 histologic fields/group) were examined (n = 5/group). The 
slides were documented using the Leica DM 2500 microscope-coupled 
capture system (Leica Microsystems, Nussloch, Germany), and tracks 
were recorded using the ImageJ® software for Windows (National 
Institute of Health, United States – NIH), available free of charge on the 
Internet (http://rsbweb.nih.gov/ij/). The system was programmed to 
recognize only a specific intensity of the red color and thus estimate the 
amount (%) of collagen per histological field [Collagen area (%) = Sirius 
red area/total area of observer field]. 

2.8. Immunohistochemistry 

PV histological sections were submitted to the antigen retrieval in 
the humid environment at 100 ◦C in 0.1 M citrate buffer for 30–45 min. 
After washing, the slides were submitted to the endogenous peroxidase 
blockade in a hydrogen peroxide/methanol solution and non-specific 
proteins binding in a 3 % BSA + 1 % goat serum solution for 1 h at 
room temperature. The sections were then incubated with proliferating 
cell nuclear antigen (PCNA, M0879, DAKO, USA) and (AR) androgen 
receptor (sc-816, Santa Cruz Biotechnology, USA) at a 1:100 dilution 
overnight at 4 ◦C. After washing with PBS, PCNA slides were incubated 
for 1 h at room temperature with goat anti-rabbit IgG-HRP antibody 
(Ab97051-Abcam, UK), and AR slides incubated with anti-mouse IgG 
antibody (Ab97023-Abcam, UK), diluted 1:200 in 1 % BSA in PBS. 
Chromogen color development was carried out with 3’3-dia-
minobenzidine tetrahydrochloride and slides were counterstained with 
Harri’s hematoxylin. 

2.9. Evaluation of gene expression (RT-qPCR) 

Collected samples of VP were kept at − 80 ºC until the moment of 
use. RNA extraction (n = 5 animals/group) was performed with the 
TriZol kit (Ambion, USA) according to the manufacturer’s instructions. 
Quantification integrity and purity of the material were verified by 
spectrophotometry in a NanoVue™ Plus (GE HealthCare Life Sciences, 
USA). The reverse transcription (RT) reaction was performed using the 
iScript™ cDNA Synthesis Kit (Bio-Rad Laboratories, Inc, CA, USA) as 
specified by the manufacturer. The mixture was incubated under the 
following conditions: 25 ◦C for 5 min, 42 ◦C for 30 min followed by 
inactivation of the reverse transcriptase at 85 ◦C for 5 min. Primers for 
the genes analyzed were designed using Primer Express® software 
(Applied Biosystems, Foster City, CA, USA), from sequences published in 
GenBank (www.pubmed.com), and synthesized by Invitrogen Life 
Technologies (Carlsbad, CA, USA) (Table 1). Thermocycling was per-
formed using the iTaq universal SYBR green kit (BIO-RAD), as specified 
by the manufacturer in the QuantStudio equipment (Life Technologies, 
USA), with the following conditions: GoTag Hot Start Polymerase acti-
vation 2 min at 95 ◦C followed by 40 cycles of 15 s at 95 ◦C and 1 min at 
60 ◦C, finally, dissociation curve in the range of 60–95 ◦C. 

PCR reactions for each gene were prepared in duplicates, for each 
sample an amplification plot was plotted showing an increase in the 
fluorescent reporter dye (ΔRn) at each cycle. From this graph, the cycle 
where the reaction crosses the detection threshold (cycle threshold - CT) 
was determined. The relative quantification of each gene was performed 
using the 2-ΔΔ CT method according to Livak and Schmittgen [39]. The 
values obtained for all samples were normalized by the ratio obtained 
between the target genes and the endogenous gene. 

2.10. Statistical analysis 

Statistical analysis was performed in GraphPad Prism® 8.01 soft-
ware (GraphPad Software Inc., San Diego, California, USA) using the 
"Shapiro-Wilk" normality test and, according to the result, a specific test 
was adopted for each analysis. Parametric data were submitted to the 
"student" T-test and were expressed by the mean ± SD (standard devi-
ation of the mean). Non-parametric data were submitted to the Mann- 
Whitney test. The groups were analyzed in pairs. All groups were 
compared with Ctrl and WD. Statistical difference between parameters 
was considered for values of p ≤ 0.05 (*) and p ≤ 0.01 (**). 

3. Results 

Food consumption among the groups differed during the experi-
mental period where 2,4-D+WD group presented a significantly lower 
chow intake, especially in the group exposed to the highest dose of the 
herbicide when compared to Control and WD groups (Fig. 1a). Mice had 
similar initial body weight (Fig. 1b) and at the end of the experimental 
period, all animals receiving WD showed a significant twofold increase 
in final body weight and absolute and relative fat weights (P < 0.01) 
compared to the Control group (Fig. 1c). However, groups that received 
2,4-D showed a significant reduction in the final body weight related to 

Table 1 
List of designated primers for RTq-PCR.  

Gene Reference code Primer code (5′ → 3′) 

Endogenous 
Actb (Actin beta) NM_007393.5 F→ AGCCTTCCTTCTTGGGTATGG 

R→ 
ACGGATGTCAACGTCACACTT 

Inflammatory markers 
Il6 (Interleukin 6) NM_001314054.1 F→ GAGCCCACCAAGAACGATAG 

R→ TCCACGATTTCCCAGAGAAC 
Il10 (Interleukin 10) NM_010548.2 F→ TAAGAGCAAGGCAGTGGAGC 

R→ 
GACACCTTGGTCTTGGAGCTTA 

Tnf-α (Tumor necrosis 
factor alpha) 

NM_001278601.1 F→ AGCCCCCAGTCTGTATCCTT 
R→ CTCCCTTTGCAGAACTCAGG 

Cellular repair and turnover markers 
Tp53 NM_001127233.1 F→ 

TCTCCGAAGACTGGATGACTG 
R→ GATCGTCCATGCAGTGAGGT 

Ki67 (Marker of 
proliferation Ki-67) 

NM_001081117.2 F→ ACCATCATTGACCGCTCCTT 
R→ TTGACCTTCCCCATCAGGGT 

Casp3 (Caspase 3) NM_001284409.1 F→ 
GCTTGGAACGGTACGCTAAGAA 
R→ 
CCACTGACTTGCTCCCATGTA 

Hormone Receptors 
AR (Androgen receptor) NM_013476.4 F→ AAAGAGCCGCTGAAGGGAAA 

R→ 
GGAGACGACAAGATGGGCAA 

Methylation markers and miRNA 
biosynthesis  

Dnmt1 (DNA 
methyltransferase 1) 

NM_001199433.1 F→ 
AGCCGCTCAAAGCAAAAAGTG 
R→ CTGGGGTTCATCCACAGCAT 

Dicer1 (Dicer 1 
ribonuclease III) 

NM_148948.2 F→ CCAGTGCTGCAGTAAGCTGT 
R→ AGGACCCATTGGTGAGGAAG 

Drosha (Drosha 
ribonuclease III) 

NM_001130149.1 F→ TAACCAGGCTGGGCTTTGAT 
R→ 
CTGCAGGATTCACAGTCTCTAC 

Oxidative Stress Markers 
Cat (Catalase) NM_009804.2 F→ ACATGGTCTGGGACTTCTGG 

R→ CAAGTTTTTGATGCCCTGGT 
Sod1 (Superoxide 

dismutase 1) 
NM_013671.3 F→ GCCCCCTGAGTTGTTGAATA 

R→ AGGCAAGGCTCTACCACTGA 
Gsr (Glutathione 

reductase) 
NM_010344.4 F→ CACGACCATGATTCCAGATG 

R→ CAGCATAGACGCCTTTGACA 
Gpx3 (Glutathione 

peroxidase 3) 
NM_001329860.1 F→ 

GTGAACGGGGAGAAAGAGCA 
R→ AGGGCAGGAGTTCTTCAGGA  

V.A. Rocha et al.                                                                                                                                                                                                                                



Reproductive Toxicology 120 (2023) 108449

4

the WD group (Fig. 1c). 
Exposure to the herbicide did not alter the absolute weight of body 

fat induced by WD, however, a significant increase in relative body fat 
weight was observed in 2,4-D+WD groups compared to the WD control 
(Fig. 1d-e). 

There was a significant increase in prostate gland weight in the WD 
group compared to the Control group but a significant reduction was 
observed in groups T2 and T3 (exposed to intermediate and high dose of 
the herbicide) when compared to the WD group (Fig. 1f). 

WD intake caused glucose intolerance in all groups and the herbicide 
doses did not modify this diet-induced intolerance (Fig. 2a-b). 

The stereological analysis, corresponding to the proportion that the 
tissue constituents occupied in the gland (Fig. 3a) revealed a significant 
increase in the epithelial and stromal compartments and a decrease in 
the luminal compartment in the WD group compared to the control 

group (Fig. 3e). In the groups exposed to 2,4-D there was a significant 
reduction in the epithelial compartment and a significant increase in the 
luminal compartment when compared to the WD group while only T3 
group showed a significant decrease in the stromal compartment when 
compared to WD group (Fig. 3e). 

Quantitatively relevant variations were observed concerning the 
distribution of collagen fibers, especially in the WD group (Fig. 3b). 
When the groups were compared about collagen quantity, there was a 
significant increase in the WD group compared to the Control group and 
a significant decrease in the herbicide-treated groups when compared to 
the WD group (Fig. 3f). 

Regarding mast cells analysis in the stroma, there was a significant 
increase in the WD group compared to the Control group, and a signif-
icant reduction especially in the T1 (lower dose) and T2 (intermediate 
dose) groups when compared to the WD group (Fig. 3c, g). 

PCNA immunostaining was used as a biomarker for proliferating cell 
analysis. The immunoreactivity was predominantly nuclear in the 
epithelial cells of the prostatic acini, however, the reactivity pattern was 
different among the groups (Fig. 4d). The WD group showed greater 
heterogeneity of immunoreactivity between positive cells (G1 late and 
S-phase) (Fig. 3h). Additionally, WD group showed an increase in the 
proliferation index compared to the Control group. In 2,4-D+WD groups 
there was a decrease in the number of labeled cells when compared to 
the WD group, mainly in G1 late phase (Fig. 3h). 

According to the results obtained from the RT-qPCR, it was observed 
that all target gene encoding inflammation-related cytokines: Inter-
leukin 10 (Il10), Interleukin 6 (Il6) and Tumor necrosis factor alpha (Tnf- 
α) increased their expression in the WD group compared to the Control 
group (Fig. 4a-c). In 2,4-D+WD groups there was a significant decrease 
in the expression of those cytokines analyzed when compared to the WD 
group (Fig. 4a-c). No significant changes were observed only in the 
expression of Il10 in the T3 group compared to the WD (Fig. 4a). 

Superoxide dismutase (Sad1), catalase (Cat), and glutathione 
reductase (Gsr) gene expression were significantly higher in the WD 

Fig. 1. : Graphical representation of parametric data: (a) chow intake (b) initial body weight, (c) final body weight, (d) absolute and (e) relative fat weight 
(epididymal, retroperitoneal, mesenteric and subcutaneous) and (f) ventral prostate weight of animals. Data are presented by mean ± SD (n = 10/group). Bars show 
statistical differences between Ctrl vs. WD, T1-T3 groups, and asterisk between WD vs. T1-T3 groups (*p ≤ 0.05; **p ≤ 0.01). 

Fig. 2. : GTT: (a) glycemic curves (b) area under the curve (AUC). Data are 
presented by mean ± SD (n = 6/group). 

V.A. Rocha et al.                                                                                                                                                                                                                                



Reproductive Toxicology 120 (2023) 108449

5

Fig. 3. : Histological sections of VP and 
details stained by (a) H&E, (b) Sirius red, 
(c) Toluidine blue, and (d) PCNA immu-
nostaining. The Arrows point to collagen 
fibers, mast cells and PCNA positive cells 
respectively. Abbreviations: lu: lumen; ep: 
epithelium; st: stroma. (e) Stereological 
analysis of the prostatic compartments, (f) 
Volume of collagen fibers, (g) Total num-
ber of mast cells, and (h) proliferation 
index from the count of PCNA-labeled 
cells. Data are presented by mean ± SD 
(n = 5/group). Bars show statistical dif-
ference between Ctrl vs. WD, T1-T3 groups 
and asterisk between WD vs. T1-T3 groups 
(*p ≤ 0.05; **p ≤ 0.01).   

V.A. Rocha et al.                                                                                                                                                                                                                                



Reproductive Toxicology 120 (2023) 108449

6

group in comparison to the Control group. In contrast, these genes had 
their expression significantly reduced in all 2,4-D treated groups 
compared to the only WD group (Fig. 4d-f). In glutathione peroxidase 3 
(Gpx3) gene expression, there was no significant change among the 
groups (Fig. 4g). 

Gene expression of different genes related to proliferation, cell repair 
and survival, and apoptosis were tested. Androgen receptor (Ar) 
expression was significantly higher in WD and T3 groups compared to 
the Control group (Fig. 5a). Similarly, Ki67 and caspase 3 (Casp3) 

expressions were higher in the WD group compared to the Control group 
(Fig. 5b-c), and only in T3 group, Ki67 expression was significantly 
higher than the Control group, and in T1 group, its expression was lower 
than the WD group (Fig. 5b). Casp3 expression was significantly reduced 
in T2 and T3 groups when compared to the Control group while all 2,4- 
D+WD groups showed reduced Casp3 expression compared to the WD 
group (Fig. 5c). Tp53 gene (tumor suppressor gene) expression was 
higher in the WD group compared to the Control group (Fig. 5d). In the 
herbicide exposed groups there was a significant decrease in Tp53 gene 

Fig. 4. : Representative graphs of gene expressions of inflammation-related cytokines: (a) Il10, (b) Il6 and (c) Tnf-α and oxidative stress: (d) Sod1, (e) Cat, (f) Gsr and 
(g) Gpx3, from RT-qPCR analysis. Gene expression was given by quantification of 2^ΔΔCT and data are presented by mean ± SD (n = 5/group). Bars show statistical 
difference between Ctrl vs. WD, T1-T3 groups and asterisk between WD vs. T1-T3 groups (*p ≤ 0.05; **p ≤ 0.01). 

Fig. 5. Representative graph of hormone receptor marker gene expression, cell repair and turnover (a) Ar, (b) Ki67, (c) Casp3, (d) Tp53 and methylation markers and 
miRNA biosynthesis (e) Drosha, (f) Dicer, and (g) Dnmt1, from RT-qPCR analysis. Gene expression is given by quantification of 2^ΔΔCT and data are presented by 
mean ± SD (n = 5/group). Bars show statistical differences between Ctrl vs. WD, T1-T3 groups, and asterisk between WD vs. T1-T3 groups (*p ≤ 0.05; **p ≤ 0.01). 

V.A. Rocha et al.                                                                                                                                                                                                                                



Reproductive Toxicology 120 (2023) 108449

7

expression compared to the WD group (Fig. 5d). 
In order to verify the involvement of key genes in the processes of 

DNA methylation and miRNA production, gene expression of Drosha, 
Dicer and Dnmt1 were evaluated. Drosha, Dicer and Dnmt1expressions 
were significantly higher in the WD group compared to the Control 
group (Fig. 5e-g), and only for Dnmt1, the T3 group showed an increased 
expression in relation to the Control group (Fig. 5g). Also, there was a 
significant reduction in the expression of these genes in all groups 
exposed to 2,4-D when compared to the WD group (Fig. 5e-g). 

4. Discussion 

Obesity and environmental exposure to different endocrine- 
disrupting chemicals (EDCs) are capable of promoting metabolic dys-
functions that affect the prostate microenvironment, these factors have 
been associated with a global increase in cancer risk, as well as patho-
logical changes in the male reproductive system [40–42]. In this context, 
the Western diet, rich in fats and simple carbohydrates and, so wide-
spread today, is associated with the emergence of several diseases, 
including prostate diseases. The consumption of high-fat diets, for 
example, has been linked to the activation and progression of PCa [43, 
44], and the development of chronic prostatic diseases [17]. The prev-
alence of obesity and its aggravators have been increasing significantly 
worldwide and has become a serious global public health problem. The 
results presented here reinforce the data described in the literature and 
highlight the deleterious effects of the obesogenic environment caused 
by WD on the prostate. 

Several studies have shown that environmental exposure to EDCs 
such as the herbicide 2,4-D has caused hormonal disturbances and 
negative effects on male reproductive health [12,45,46]. According to 
International Agency For Research on Cancer (IARC) [47], 2,4-D is 
possibly carcinogenic to humans and potentially toxic, and for that 
reason, restrictions on 2,4-D use have been intensified, however, its 
production and use are still increasing. Because of the damage to human 
health that herbicides can cause, we also investigated the effect of a 
combined exposure of WD plus 2,4-D at low doses and showed that 2,4-D 
was able to modulate the WD effects in a combined exposure. 

Officially recognized as a global disease [48], obesity is defined as a 
pathological state characterized by excessive fat accumulation [49]. In 
the present study, WD promoted a gain in body mass with an increase in 
adipose tissue and glucose intolerance, indicating a metabolic disorder 
characteristic of obesity. These data corroborate a previous study using 
the same protocol for WD [8], and studies that showed that the con-
sumption of high-fat and high-calorie diets influenced the increase in 
body mass, fat storage, and elevation of serum levels of glucose, as well 
as, impaired glucose tolerance [40–52]. Reduction in food intake in 2, 
4-D plus WD-exposed animals is a common symptom of phenoxyacetic 
herbicide exposure [53]. Moreover, reduced final body mass in 2,4D 
exposed animals could be a direct consequence of lower food intake as 
observed in this study. 

Our results demonstrated that WD was able to induce biometrical 
and morphological changes in the prostate. The increase in VP weight 
observed in the only WD- group was described in a similar study [54], 
and probably could be related to the increase in the androgenic response 
(increase in the Ar expression). Additionally, an increase in the in-
flammatory signals in the tissue like chemokines and cytokines drives 
the prostatic epithelium and stroma to produce mitogenic signals that 
could contribute to prostate growth [55,56]. 

The prostate stroma, responsible for ensuring the transmission of 
soluble chemical signals and providing structural support to the pros-
tate, is closely related to the epithelium [20], which, by responding to 
androgenic stimuli, is also responsible for assisting the development, 
growth, and survival of the epithelium [57]. Our results showed an in-
crease of the stromal compartment and a decrease of the luminal portion 
in the WD group, and this could have a relationship with the increase of 
extracellular matrix (ECM) in the VP, since it was observed an increase 

in collagen quantity. 
WD has been associated with an increase in stromal components, 

especially collagen fibers. Studies have indicated that alterations in the 
collagenous material of the stroma may represent a favorable environ-
ment for the growth and invasion of tumor cells, since collagen fibers, 
associated with the other cellular components, are extremely important 
for the maintenance of the architecture of the ECM on the prostate tis-
sue. Therefore, different reports have showed that the collagen fibers 
distribution can be associated with invasive phenotype and support the 
migration and proliferation of cancer cells [58–60]. In this sense, the 
increase observed in the collagen fibers, probably it is associated with 
the possible structural response to recover the tissue damage induced by 
the treatment stress and consequently triggering the tissue remodeling. 
Tamarindo et al. [61] observed similar variations in their study where 
there was a significant increase in collagen fibers in the prostate of rats 
in an obesity condition induced by consumption of a high-fat diet. 2,4-D 
associated with WD intervention was able to decrease the changes 
induced by WD on the collagen quantity, prostate weight and stereo-
logical parameters, demonstrating an asynergy between both experi-
mental conditions. 

Androgen receptor is indispensable for prostate development and 
plays a key role in regulating its physiology (cell survival and secretion) 
after puberty, however, alterations in its activity may be linked to the 
development and progression of PCa, especially in early tumors [62,63]. 
In our results, WD and combined exposure with the highest dose of 2,4-D 
(20 mg/kg/day) were able to increase Ar expression in VP. Additionally, 
there were an increase in epithelial proliferation index (PCNA) and Ki67 
expression in the same groups, evidenced by enlargement of the 
epithelial compartment, which makes us believe that the observed hy-
perplasia has been regulated by androgenic action induced by obesity, as 
it has been supported by the literature [64]. 

Obesity characterized by excess body fat is responsible for the 
increased expression of inflammatory substances. IL-10 produced 
mainly by activated CD8 + cells is an essential anti-inflammatory 
cytokine, acting to inhibit macrophage and T-cell activity, and helps 
as a co-stimulator for the proliferation of mast cells and their progenitors 
intimately involved in the inflammatory process [65,66]. The increase in 
Il10 gene expression in the prostate of the WD group can suggests a 
possible reduction of inflammatory microenvironmental induced by WD 
in this organ. Carvalho [67] showed that overweight in adolescents was 
able to increase peripheral expression of IL10, which could be an indi-
cation that obesogenic environment is inflammatory. Moreover, there 
was an increase in the number of mast cells in WD group, which rein-
force evidence of an immerging inflammatory environment in the 
prostate. Mast cells are among the first cells recruited to the stroma in 
the acute phase of inflammation [68]. Besides being inflammatory me-
diators, mast cells are related to tissue remodeling, fibrosis, defense 
against infectious agents, angiogenesis, and cancer [69,70]. Thus, one of 
the hypotheses that justify the increase in the stromal collagen quantity 
of WD animals would be an increase in mast cell signaling for tissue 
remodeling in these animals. 

Studies have shown that hypertrophy of adipocytes causes an infil-
tration and activation of macrophages in the tissue, increasing the 
production of pro-inflammatory cytokines, such as TNF-α and IL-6, 
which in turn results in an increase in the chronic low-grade inflam-
matory process, associated with the development of insulin resistance 
[71,72]. Data from the literature have shown that TNF-α may be a 
possible molecular mediator between obesity and insulin resistance 
since neutralization of TNF-α enhances resistance to insulin action in 
obese mice [73,74]. Our results showed an increase in Tnf-α gene 
expression in the WD group, which may be related to insulin resistance, 
resulting in glucose intolerance, observed through the glucose tolerance 
test in the same group. 

Additionally, TNF-α also has the ability to inhibit tumor cell prolif-
eration, promote apoptosis and regulate IL-6 synthesis [75–77]. An in-
crease in Il-6 and Tnf-α expression in the WD group possibly evidences a 

V.A. Rocha et al.                                                                                                                                                                                                                                



Reproductive Toxicology 120 (2023) 108449

8

marked inflammatory process in the tissue and may indicate an increase 
in the susceptibility to developing prostate disorders. On the other hand, 
in 2,4D treated groups there was a reduction in the number of mast cells 
in the stroma and cytokines gene expression, pointing to a probable 
attenuation of the inflammatory microenvironment or by changing in-
flammatory response in the prostate induced by WD feeding. 

A significant increase in the expression of genes encoding the anti-
oxidant enzymes SOD, CAT, GSR was observed in the prostate of the 
only WD-exposed group. These results may be directly associated with 
the negative consequences of obesity, indicating an oxidative stress 
environment, which has been pointed out as an important agent in the 
development of various types of diseases [78,79]. Studies have revealed 
that oxidative stress affects the development and progression of PCa, 
since the increase in reactive oxygen species (ROS) leads to DNA dam-
age, alterations in transcription and replication, activation of survival 
signaling transduction pathways, and genomic instability: the basis of 
carcinogenesis [80,81]. In our model, obesity probably induced oxida-
tive stress in the tissue and triggered a protective mechanism based on 
the synthesis of antioxidant enzymes. Furthermore, we observed a sig-
nificant decrease of Sod1, Cat, and Gsr expression in animals exposed to 
the combination of WD and 2,4-D, bringing their levels to those found in 
the negative control group. Thus, once again, the reduction of effects of 
obesity on prostate by 2,4-D exposition seems to modulate the antioxi-
dant response. 

In addition to inflammation, the adipose tissue of obese individuals 
shows evidence of cellular senescence, with positive regulation of Tp53 
expression which is the main protein act