i UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO DE MESQUITA FILHO” FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA DE BOTUCATU CAMPUS BOTUCATU ATIVIDADE IN VITRO DO EXTRATO RICO EM CANABIDIOL NA EXPRESSÃO GÊNICA DE CITOCINAS INFLAMATÓRIAS E FATORES NEUROTRÓFICOS DE CÉLULAS-TRONCO MESENQUIMAIS EQUINAS BEATRIZ DA COSTA KAMURA BOTUCATU – SÃO PAULO SETEMBRO – 2022 ii UNIVERSIDADE ESTADUAL PAULISTA “JÚLIO DE MESQUITA FILHO” FACULDADE DE MEDICINA VETERINÁRIA E ZOOTECNIA DE BOTUCATU ATIVIDADE IN VITRO DO EXTRATO RICO EM CANABIDIOL NA EXPRESSÃO GÊNICA DE CITOCINAS INFLAMATÓRIAS E FATORES NEUROTRÓFICOS DE CÉLULAS-TRONCO MESENQUIMAIS EQUINAS BEATRIZ DA COSTA KAMURA Dissertação apresentada à Faculdade de Medicina Veterinária e Zootecnia, Campus de Botucatu, Unesp, para obtenção do título de Mestre no Programa de Pós-graduação em Medicina Veterinária. Orientador: Prof. Dr. Rogério Martins Amorim BOTUCATU – SÃO PAULO SETEMBRO – 2022 Palavras-chave: Cannabis; Imunomodulação; Neurorregeneração; Neurotrofinas; Terapia celular. Kamura, Beatriz da Costa. Extrato rico em canabidiol suprime a ativação dos genes pró-inflamatórios interleucina 1ß e interleucina-6 em células-tronco mesenquimais equinas / Beatriz da Costa Kamura. - Botucatu, 2022 Dissertação (mestrado) - Universidade Estadual Paulista "Júlio de Mesquita Filho", Faculdade de Medicina Veterinária e Zootecnia Orientador: Rogério Martins Amorim Capes: 50501062 1. Terapia celular. 2. Cannabis. 3. Interleucinas. 4. Imunomodulação. 5. Fatores de crescimento neural. DIVISÃO TÉCNICA DE BIBLIOTECA E DOCUMENTAÇÃO - CÂMPUS DE BOTUCATU - UNESP BIBLIOTECÁRIA RESPONSÁVEL: ROSEMEIRE APARECIDA VICENTE-CRB 8/5651 FICHA CATALOGRÁFICA ELABORADA PELA SEÇÃO TÉC. AQUIS. TRATAMENTO DA INFORM. iii TÍTULO: ATIVIDADE IN VITRO DO EXTRATO RICO EM CANABIDIOL NA EXPRESSÃO GÊNICA DE CITOCINAS INFLAMATÓRIAS E FATORES NEUROTRÓFICOS DE CÉLULAS-TRONCO MESENQUIMAIS EQUINAS COMISSÃO EXAMINADORA __________________________________ Prof. Dr. Rogério Martins Amorim Presidente e Orientador Departamento de Clínica Veterinária FMVZ – UNESP – Botucatu, são Paulo. __________________________________ Prof. Dr. Carlos Eduardo Fonseca Alves Membro da Banca Departamento de Cirurgia Veterinária e Reprodução Animal FMVZ – UNESP – Botucatu, São Paulo. __________________________________ Dr. Erik Amazonas de Almeida Membro da Banca Universidade Federal de Santa Catarina - Curitibanos, Santa Catarina. Data da Defesa: 23 de setembro de 2022. iv AGRADECIMENTOS À minha família pelo apoio incondicional, incentivo e por estarem ao meu lado em todos os momentos da minha trajetória, vocês são um exemplo de vida e sem vocês este trabalho não seria possível. Agradeço ao meu orientador, Prof. Dr. Rogério Martins Amorim, pela vivência, orientação e ensinamentos, que decorrem desde o período do estágio curricular, residência e agora, durante a pós-graduação. Aos meus colegas e amigos Natielly Dias Chimenes, Lucas Vinícius de Oliveira Ferreira e João Pedro Marmol de Oliveira, pelo apoio, incentivo e ajuda que foram essenciais para a realização deste projeto. Ao pós-doutorando Dr. Diego Noé Rodríguez Sánchez, pela paciência e ensinamentos durante a realização deste projeto. O presente trabalho foi realizado com apoio da Coordenação de Aperfeiçoamento de Pessoal de Nível Superior – Brasil (CAPES) - Código de Financiamento 001. Muito obrigada. v LISTA DE FIGURAS Figure 1. Vias de síntese e degradação dos endocanabinóides. .................................... 11 Figure 2. Cell metabolic activity (%) of experimental groups treated with DMEM, 0.05% DMSO and CBD 3, 5, 7 and 9 µM after 24 and 48 hours of treatment. The group treated with CBD 9 µM showed a significant difference in relation to the control group (*) and treated with 0.05% DMSO (**) after 24 hours. P value: P<0.01. ................................................................................................................ 30 Figure 3. Relative expression of BDNF (A), GDNF (B), NGF (C), IL-1ß (D), IL-6 (E), IL-10 (F), TNF-ɑ (G) and IFN-ɣ (H) between experimental groups at 24 and 48 hours. Data were represented as median, and 25th and 75th percentiles. P values: P<0.001*, P<0.01**, P<0.05***. ......................................................................... 33 vi LISTA DE APÊNDICES Appendix 1. Analysis of the extract rich in cannabidiol through the method of high performance liquid chromatography (HPLC) by the company DALL Soluções Analíticos e Empresariais..................................................................................... 43 Appendix 2. Tables referring to the relative gene expression of cytokines and neurotrophic factors ............................................................................................. 44 vii LISTA DE SIGLAS E ABREVIATURAS 2-AG - 2-araquidonoilglicerol AEA – Anandamida BDNF – Fator neurotrófico derivado do cérebro CB1 – Receptor canabinóide 1 CB2 – Receptor canabinóide 2 CBD – Canabidiol cDNA – DNA complementar CTM – Células-tronco mesenquimais CTM-MO – Células-tronco mesenquimais derivadas da medula óssea CTM-TA – Células-tronco mesenquimais derivadas do tecido adiposo CTM-CU – Células-tronco mesenquimais derivadas do sangue do cordão umbilical CTM-TU – Células-tronco mesenquimais derivadas do tecido do cordão umbilical CTM-PL – Células-tronco mesenquimais derivadas da placenta DAGL – Lipase de diacilglicerol DMEM - Dulbecco’s Modified Eagle’s Medium DMSO – Dimetilsulfóxido DPBS - Dulbecco's phosphate-buffered saline ELA - Esclerose lateral amiotrófica FAAH – Amida hidrolase de ácidos graxos GDNF – Fator neurotrófico derivado da glia GM-CSF - Fator estimulador de colônias de granulócitos e macrófagos Il-1ɑ – Interleucina-1 alfa Il-1ß – Interleucina-1 beta IL-4 – Interleucina-4 IL-6 – Interleucina-6 IL-10 – Interleucina-10 IL-13 – Interleucina-13 INF-ɣ - Interferon gama LPS – Lipopolissacarídeo M2 – macrófagos com fenótipo anti-inflamatório MAGL – Lipase de monoacilglicerol MAPK - Proteínas quinase ativadas por mitógeno MTT - Sal de tetrazólio µM – Micromolar NAPE-PDL – N-acil fosfatidiletanolamina fosfolipase D NF-κB - Fator nuclear kappa B NGF – Fator de crescimento do nervo SFB – Soro fetal bovino sIL-6R - Complexo solúvel IL-6R STAT - Fator de transcrição STAT1- Fator de transcrição 1 STAT3 - Fator de transcrição 3 TGF-ß – Fator de crescimento transformador TNF-ɑ - Fator de necrose tumoral TLR – Receptor Toll-like TLR4 – Receptor toll-like 4 TrkB - Receptor quinase B de tropomiosina TRPV1 - Receptor vaniloide tipo-1 viii VEGF - Fator de crescimento endotelial vascular ix SUMÁRIO RESUMO..............................................................................................................1 ABSTRACT .........................................................................................................3 Capítulo 1 .............................................................................................................5 1.1 INTRODUÇÃO ........................................................................................5 1.2 REVISÃO DE LITERATURA ................................................................6 1.2.1 Sistema nervoso periférico ...............................................................6 1.2.1.1 Classificação das lesões nervosas periféricas ...............................7 1.2.1.2 Lesões ao sistema nervoso periférico ...........................................8 1.2.2 Cannabis sativa .................................................................................9 1.2.3 Sistema endocanabinóide .................................................................9 1.2.4 Canabidiol ....................................................................................... 11 1.2.5 Células-tronco mesenquimais ........................................................ 13 1.2.5.1 Ativação das Células tronco mesenquimais ............................... 13 1.2.5.2 Participação das CTM na regeneração nervosa ........................ 14 1.3 HIPÓTESE ............................................................................................. 15 1.4 OBJETIVOS .......................................................................................... 15 1.4.1 Objetivo geral ................................................................................. 15 1.4.2 Objetivos específicos ....................................................................... 15 1.5 REFERÊNCIAS .......................................................................................... 16 Capítulo 2 ........................................................................................................... 23 1.6 TRABALHO CIENTÍFICO ........................................................................... 23 1 KAMURA, B. C. Atividade in vitro do extrato rico em canabidiol na expressão gênica de citocinas inflamatórias e fatores neurotróficos de células-tronco mesenquimais equinas. Botucatu, 2022. 46p. Dissertação (Mestrado) – Faculdade de Medicina Veterinária e Zootecnia, Campus de Botucatu, Universidade Estadual Paulista. RESUMO As lesões ao sistema nervoso periférico são relativamente comuns na espécie equina, sendo as causas mais frequentemente observadas as originadas por processos traumáticos e inflamatórios. Muitas vezes lesões de maior gravidade, que apresentam uma maior distância entre as extremidades remanescentes ou um maior tempo de evolução, podem carecer de estímulos inflamatórios e neurotróficos, essenciais para o processo de limpeza dos debris celulares e preparo do ambiente para que ocorra a regeneração axonal. A instituição de terapias que visem o restabelecimento de um ambiente propício à regeneração, do mesmo modo que nutra e estimule o processo de reparo tecidual, muitas vezes se mostram benéficas. Assim, a interação do canabidiol com receptores, moléculas e vias de sinalização celulares têm se mostrado mecanismos importantes para o desencadeamento de respostas anti-inflamatórias e neurorregenerativa. Neste trabalho, hipotetizamos que as CTM equinas derivadas do tecido adiposo, quando cultivadas com extrato de Cannabis sativa rico em canabidiol, apresentam aumento do seu potencial imunomodulatório e neurorregenerativo. Assim, analisamos a capacidade do extrato rico em canabidiol em estimular as CTM-TA equinas à expressar genes relacionados ao seu potencial anti-inflamatório e neurotrófico em ambiente inflamatório. Foram utilizadas CTM derivadas do tecido adiposo equino proveniente do banco de células do nosso laboratório e previamente caracterizadas, demonstrando potencial de diferenciação nas linhagens adipogênica, osteogênica e condrogênica, expressão dos marcadores de superfície CD105, CD44 e CD90 e baixa expressão ou ausência dos marcadores CD34 e MHC II. As CTM de quatro animais distintos foram separadas em seis grupos experimentais e incubadas por 24 e 48 horas. A taxa de viabilidade e proliferação celular foi analisada por meio do teste de MTT, sendo realizada em seis grupos experimentais: Grupo controle (CTM-TA), Grupo veículo (CTM-TA + 0,05% DMSO) e grupos tratados com extrato rico em canabidiol nas doses de 3 µM (CTM-TA + CBD 3 µM), 5 µM (CTM-TA + CBD 5 µM), 7 µM (CTM-TA 2 + CBD 7 µM) e 9 µM (CTM-TA + CBD 9 µM) nos momentos 24 e 48 horas. A análise da expressão gênica foi realizada nos seis grupos experimentais: Grupo controle (CTM-TA), Grupo estimulado com LPS (CTM-TA + 10 ng/ml LPS), Grupo veículo (CTM-TA + LPS + 0,05% DMSO) e grupos estimulados e tratados extrato rico em canabidiol nas doses de 3 µM (CTM-TA + 10 ng/ml LPS + CBD 3 µM), 5 µM (CTM-TA + 10 ng/ml LPS + CBD 5 µM) e 7 µM (CTM-TA + 10 ng/ml LPS + CBD 7 µM) em dois momentos distintos (24 e 48 horas). A viabilidade das CTM equinas se apresentou reduzida apenas quando cultivadas com o extrato rico em canabidiol na dose de 9µM por um período de 24 horas. Foi possível notar a redução na expressão dos genes relacionados às citocinas pró-inflamatórias IL-6 (P<0,001) e IL-1ß (P<0,05), assim como a redução de NGF (P<0,001). Os resultados obtidos indicam que o tratamento in vitro das CTM-TA equinas com extrato rico em canabidiol foi capaz de promover o aumento de sua capacidade imunomodulatória. Entretanto, não foi eficiente no aumento do potencial neurorregenerativo das CTM-TA equinas. Novos estudos devem ser realizados com diferentes arranjos experimentais para a melhor compreensão dos efeitos imunomoduladores e neuroregenerativos da estimulação in vitro dos receptores canabinoides das CTM-TA equinas. Palavras chave: Cannabis, imunomodulação, neurorregeneração, neurotrofinas, terapia celular. 3 KAMURA, B. C. In vitro activity of cannabidiol-rich extract in the gene expression of inflammatory cytokines and neurotrophic factors in equine mesenchymal stem cells. Botucatu, 2022. 46p. Dissertação (Mestrado) – Faculdade de Medicina Veterinária e Zootecnia, Campus de Botucatu, Universidade Estadual Paulista. ABSTRACT Injuries to the peripheral nervous system are relatively common in the equine species, and the most frequently observed causes are those originating from traumatic and inflammatory processes. Often more severe lesions, which present a greater distance between the remaining extremities or a longer evolution time, may lack inflammatory and neurotrophic stimuli, essential for the process of cleaning cellular debris and preparing the environment for axonal regeneration. Thus, the institution of therapies that aim to restore an environment conducive to regeneration, as well as nourish and stimulate the tissue repair process, often prove to be beneficial. Thus, the interaction of cannabidiol with receptors, molecules and cellular signaling pathways have been shown to be important mechanisms for triggering anti-inflammatory and neuroregenerative responses. In this work, we hypothesized that equine MSCs derived from adipose tissue, when cultivated with Cannabis sativa extract rich in cannabidiol, show increased immunomodulatory and neuroregenerative potential. Thus, we analyzed the ability of the cannabidiol-rich extract to stimulate equine Ad-MSC to express genes related to its anti-inflammatory and neurotrophic potential in an inflammatory environment. MSCs derived from equine adipose tissue from the cell bank of our laboratory and previously characterized were used, demonstrating potential for differentiation in adipogenic, osteogenic and chondrogenic lineages, expression of surface markers CD105, CD44 and CD90 and low expression or absence of CD34 markers and MHC II. MSCs from four different animals were separated into six experimental groups and incubated for 24 and 48 hours. The cell viability and proliferation rate was analyzed using the MTT test, being performed in six experimental groups: Control Group (Ad-MSC), Vehicle Group (Ad-MSC + 0.05% DMSO) and groups stimulated and treated with extract rich in cannabidiol in doses of 3 µM (Ad-MSC + CBD 3 4 µM), 5 µM (Ad-CTM + CBD 5 µM), 7 µM (Ad-CTM + CBD 7 µM) and 9 µM (Ad-CTM + CBD 9 µM) at 24 and 48 hours. Gene expression analysis was performed in the six experimental groups: Control group (Ad-MSC), LPS-stimulated group (Ad-MSC + 10 ng/ml LPS), Vehicle group (Ad-MSC + LPS + 0.05% DMSO) and groups stimulated and treated with cannabidiol-rich extract at doses of 3 µM (Ad-MSC + 10 ng/ml LPS + CBD 3 µM), 5 µM (Ad-MSC + 10 ng/ml LPS + CBD 5 µM) and 7 µM (Ad-MSC + 10 ng/ml LPS + CBD 7 µM) at two different times (24 and 48 hours). The viability of equine MSCs was reduced only when cultivated with the extract rich in cannabidiol at a dose of 9µM for a period of 24 hours. It was possible to notice the reduction in the expression of genes related to the pro-inflammatory cytokines IL-6 (P<0.001) and IL-1ß (P<0.05), as well as the reduction of NGF (P<0.001). The results obtained indicate that the in vitro treatment of equine Ad-MSC with an extract rich in cannabidiol was able to promote an increase in its immunomodulatory capacity. However, it was not efficient in increasing the neuroregenerative potential of equine Ad-MSC. New studies should be carried out with different experimental arrangements for a better understanding of the immunomodulatory and neuroregenerative effects of in vitro stimulation of cannabinoid receptors of equine Ad- MSC. Keywords: Cannabis, cell therapy, immunomodulation, neuroregeneration, neurotrophins. 5 Capítulo 1 1.1 INTRODUÇÃO Em humanos, as neuropatias periféricas apresentam uma incidência anual de 77 pessoas a cada 100.000 habitantes (LEHMANN et al., 2020). Um levantamento realizado por Peitersen (2002), no qual foram analisados 2.570 casos de paralisia do nervo facial num período de 25 anos, constatou-se que a principal causa era a de origem idiopática, responsável por cerca de 66% dos casos, sendo o restante referente a afecções congênitas, infecciosas, traumáticas, metabólicas, inflamatórias, neoplásicas, vasculares, entre outras. Na espécie equina, as causas mais comumente encontradas de lesões ao sistema nervoso periférico são as de origem traumática e inflamatória (DE LAHUNTA; GLASS; KENT, 2015; BOORMAN et al., 2020). As lesões nervosas periféricas podem resultar em perda motora, sensitiva e autonômica, e embora o restabelecimento funcional possa ocorrer, fatores como gravidade, tipo de lesão, distância dos cotos axonais, o não alinhamento das extremidades e a possibilidade ou não de intervenção acabam influenciando sua taxa de recuperação (UDINA et al., 2011). Devido à sua capacidade de proliferação, diferenciação, potencial anti-inflamatório, imunomodulador e de secreção de fatores neurotróficos, as CTM têm se mostrado uma importante ferramenta no tratamento de lesões que acometam o sistema nervoso periférico (SANCHEZ et al., 2017). Como adjuvante à terapia celular, pesquisas realizadas com CTM in vitro ou em modelo murino in vivo já demonstraram a capacidade do composto derivado da Cannabis sativa, canabidiol (CBD), no auxílio do tratamento de doenças que afetam o sistema nervoso central e periférico (MARCHALANT et al., 2008; RODRIGUES et al., 2019; WONG; CAIRNS, 2019). Essa capacidade se dá devido à interação deste fitocanabinóide com receptores de membrana, canabinóides endógenos e enzimas de degradação presentes no organismo, os quais fazem parte do sistema endocanabinóide, embora também apresente ação sobre vias não correlacionadas a tal sistema (COORAY; GUPTA; SUPHIOGLU, 2020). Assim, a interação do CBD com receptores, moléculas e 6 vias de sinalização celulares são as responsáveis por desencadear suas respostas anti- inflamatórias e neurorregenerativas (LIBRO et al., 2016; PEYRAVIAN et al., 2020). 1.2 REVISÃO DE LITERATURA 1.2.1 Sistema nervoso periférico O sistema nervoso periférico é formado pela interação entre três principais componentes: os neurônios, que podem ser compostos por fibras sensoriais, motoras e autonômicas e são as células responsáveis pela condução do estímulo nervoso; as células de Schwann, produtoras da bainha de mielina e capazes de secretar citocinas e fatores neurotróficos; e o tecido conjuntivo, responsável por fornecer suporte mecânico e proteção às fibras nervosas (MENORCA; FUSSELL; ELFAR, 2013). De acordo com a sua localização, função e composição, o tecido conjuntivo pode ser diferenciado em endoneuro, perineuro e epineuro (OSAWA et al., 1999; VERHEIJEN et al., 2003). O endoneuro é a camada mais interna do tecido conjuntivo, a qual se mantem em contato direto com os axônios e células de Schwann (UBOGU, 2013). Este fator, associado à presença de vasos sanguíneos em sua composição, faz com que seja o responsável pelo suprimento de oxigênio e nutrientes necessários para os processos celulares (GRINSELL; KEATING, 2014). Um grupo de axônios com suas respectivas bainhas de mielina e endoneuro formam os fascículos, os quais são envoltos pelo perineuro (UBOGU, 2013). Ainda, o perineuro apresenta em sua composição as chamadas células perineurais ou mioepiteliais, as quais devido às suas propriedades elásticas e de contração promovem certa proteção mecânica à forças externas (LIU; WANG; YI, 2018). O epineuro é a camada mais externa do tecido conjuntivo, envolvendo grupos de fascículos e toda a fibra nervosa (GRINSELL; KEATING, 2014). 7 1.2.1.1 Classificação das lesões nervosas periféricas Atualmente são conhecidos dois métodos de classificação das lesões ao sistema nervoso periférico, os quais são baseados na presença e na extensão dos danos à bainha de mielina, axônio e tecido conjuntivo (MENORCA; FUSSELL; ELFAR, 2013). Segundo Seddon (1943), as lesões podem ser classificadas em três tipos: a neuropraxia, na qual ocorre o comprometimento do funcionamento apenas da bainha de mielina, com o axônio e tecido conjuntivo íntegros; a axonotmese, definida como lesão ao axônio, bainha de mielina, endoneuro e perineuro, porém sem comprometimento do epineuro; e a neurotmese, havendo perda da função axonal, da bainha de mielina e perda da continuidade do tecido conjuntivo local. O modelo descrito por Sunderland (1951) apresenta uma classificação que varia do I ao V, sendo os modelos I e V equivalentes à neuropraxia e neurotmese de Seddon, respectivamente. Já os graus II, III e IV, embora também tenham relação com a classificação de axonotmese descrita anteriormente, apresentam algumas particularidades: enquanto o grau II é definido pela lesão apenas do axônio e bainha de mielina, os graus III e IV fazem referência ao acometimento também do endoneuro e perineuro, respectivamente. A neuropraxia, ou Sunderland I, é uma lesão caracterizada pela alteração da condução do estímulo nervoso, não interferindo na integridade axonal (BURNETT; ZAGER, 2004). Assim, o seu prognóstico é bom a reservado, obtendo um retorno considerável à funcionalidade mesmo sem intervenção (KAMBLE; SHUKLA; BHAT, 2019). Por outro lado a axonotmese e neurotmese, ou Sunderland II a V, são lesões que cursam com comprometimento axonal, o que devido a diversas alterações celulares e moleculares locais promove a degeneração do axônio em sua região distal à lesão (BURNETT; ZAGER, 2004; ROTSHENKER, 2011). Com isso, o seu prognóstico é reservado a ruim, principalmente nos casos de neurotmese ou Sunderland V, sendo muitas vezes necessária a intervenção cirúrgica para que o retorno parcial ou completo seja alcançado (PEREIRA et al., 2014; CRUZ; DE JESUS, 2021). 8 1.2.1.2 Lesões ao sistema nervoso periférico Após as lesões nervosas periféricas, diversos eventos celulares e moleculares tomam início com o objetivo de promover a regeneração axonal e a reinervação do tecido alvo, o que recebe o nome de degeneração Walleriana (ROTSHENKER, 2011). Este processo de reparação é influenciado por diversos fatores, como natureza e gravidade da lesão, distância ao órgão-alvo, idade, tipo de fibra lesada, entre outros (DA SILVA; CAMARGO, 2010). A degeneração Walleriana é caracterizada pela degeneração do citoesqueleto axonal na região distal à lesão, fagocitose dos debris celulares e promoção de um ambiente que suporte o crescimento e regeneração axonal (GRIFFIN; THOMPSON, 2008). Esta fase também pode ser dividida em dois momentos distintos, no qual o primeiro, que ocorre antes da chegada dos macrófagos ao local da lesão, é caracterizado pela produção de citocinas pró-inflamatórias, como TNF-ɑ, IL-1ɑ, IL-1ß, fator estimulador de colônias de granulócitos e macrófagos (GM-CSF) e IL-6, enquanto a segunda fase, que ocorre após a chegada dos macrófagos, é caracterizada pela produção de moléculas anti-inflamatórias, como IL-6, IL- 10 e fator inibitório de GM-CSF (ROTSHENKER, 2011). Nos primeiros estágios das lesões nervosas periféricas, o aumento da produção de citocinas inflamatórias IL-1ß, IL-6, TNF-ɑ e IFN-ɣ é promovido pelas próprias células de Schwann, macrófagos e células de defesa locais, com o objetivo de recrutamentos de células imunes e fagocitose dos debris celulares (LI et al., 2022). As células de Schwann são as primeiras a promover o aumento da expressão e produção das citocinas IL-1ß e TNF-ɑ o que, além de gerar o estímulo para o recrutamento de macrófagos, faz com que aumente a secreção de IL-6 pelos fibroblastos locais (SHAMASH; REICHERT; ROTSHENKER, 2002). A redução da produção de IL-1ß e TNF-ɑ ocorre concomitantemente à chegada dos macrófagos ao local da lesão, os quais devido à presença de Apolipoproteína-E e Galectina- 3 secretadas pelas células de Schwann e macrófagos durante a degeneração Walleriana, são polarizados para o seu fenótipo anti-inflamatório (M2), secretando uma maior quantidade de IL-10 (AAMAR; SAADA; ROTSHENKER,1992; SAADA et al., 1995). A IL-10 é uma importante citocina anti-inflamatória, atuando na redução da atividade do fator nuclear 9 kappa B (NF-κB) e consequentemente na via de sinalização responsável pela síntese de proteínas pró-inflamatórias, como IL-1ß e TNF-ɑ (CLARK; OLD; MALCANGIO, 2013). Ao mesmo tempo em que ocorre o processo de remoção dos debris celulares, liderado por macrófagos e células de Schwann, as próprias células de Schwann iniciam a secreção de diversos fatores neurotróficos como o fator de crescimento nervoso (NGF), fator neurotrófico derivado do cérebro (BDNF), fator neurotrófico derivado da glia (GDNF) e neurotrofina-3 (NT-3), que estabilizam o citoesqueleto axonal e o guiam durante a regeneração (TOMITA et al., 2013; CAILLAUD et al., 2019; PANDEY; MUDGAL, 2021). 1.2.2 Cannabis sativa A planta Cannabis sativa provavelmente foi introduzida no Brasil em meados de 1500, junto à chegada das primeiras caravelas e escravos vindos de Portugal, entretanto o seu uso medicinal foi reconhecido apenas ao final do século XIX. Foram nas décadas de 1920 e 1930 que deu-se início à repressão ao uso terapêutico da cannabis, o que culminou com a proibição do cultivo e uso da planta (CARLINI, 2006). Apenas a partir da década de 1960, sob a liderança do professor Elisaldo Carlini, que os estudos acerca dos canabinóides ganharam maior força e visibilidade no país, principalmente no que se referia ao campo da neurologia (CARLINI; KRAMER, 1965; ZUARDI, 2006). 1.2.3 Sistema endocanabinóide A identificação dos dois principais componentes responsáveis pelos efeitos terapêuticos da Cannabis sp., canabidiol (CBD) e Δ9-tetrahidronacabidiol (THC), se deu respectivamente nos anos de 1963 e 1964, o que iniciou os estudos acerca dos receptores e ligantes endógenos do que futuramente seria chamado de sistema endocanabinóide (GAONI; MECHOULAM, 1964; MECHOULAM; SHVO, 1963). Assim, no final da década de 1980 e início da década de 90, deram-se as descobertas do receptor canabinóide tipo 1 (CB1) e tipo 2 (CB2) e de seus ligantes endógenos anandamida (AEA) e 2- 10 araquidonoilglicerol (2-AG) (DEVANE et al., 1988; DEVANE et al., 1992; MUNRO; THOMAS; ABU-SHAAR, 1993; MECHOULAM et al., 1995). Atualmente, o sistema endocanabinóide tem como base a interação entre três elementos: os receptores de membrana, como receptores CB1 e CB2; os agonistas endógenos ou endocanabinóides AEA e 2-AG, os principais e mais estudados; e os componentes enzimáticos responsáveis pela síntese e degradação dos endocanabinóides, como as enzimas N-acil fosfatidiletanolamine fosfolipase D (NAPE-PDL) e lipase de diacilglicerol (DAGL) e amida hidrolase de ácidos graxos (FAAH) e lipase de monoacilglicerol (MAGL), respectivamente (RODRÍGUEZ DE FONSECA et al., 2005; BATTISTA et al., 2012). O seu funcionamento apresenta grande importância na homeostase de diversos tecidos do organismo, sendo os seus componentes encontrados em diversas células e tecidos, como sistema nervoso central e periférico, cardiovascular, hematopoiético, gastrointestinal, entre outros, e sendo observadas alterações em suas vias de sinalização em estados patológicos com o objetivo de restabelecimento do equilíbrio (LIGRESTI; PETROSINO; DI MARZO, 2009). Os endocanabinóides são moléculas sintetizadas de acordo com a demanda, ou seja, sem capacidade de armazenamento, e exercem as suas funções principalmente por meio do mecanismo de sinalização retrógrada, agindo sobretudo nos receptores CB1 presentes na membrana pré-sináptica (Figura 1) (RODRÍGUEZ DE FONSECA et al., 2005). Além dos endocanabinóides, mediadores lipídicos compostos por ácidos graxos poli- insaturados de cadeia longa e derivados do ácido araquidônico, os fitocanabinóides são importantes alvos de pesquisa no tratamento de diversas doenças em humanos e animais (PACHER; BÁTKAI; KUNOS, 2006; BATTISTA et al., 2012; SILVER, 2021). O termo fitocanabinóides faz referência ao grupo de componentes lipofílicos derivados da planta Cannabis sativa que, embora estruturalmente sejam diferentes dos endocanabinóides, também são capazes de se ligar e evocar respostas de receptores canabinóides e não- canabinóides, como receptor vaniloide tipo-1 (TRPV1), receptores ativados por proliferadores de peroxissoma (PPAR), receptor acoplado à proteína G55, entre outros, sendo o CBD e o THC os principais fitocanabinóides atualmente estudados isolados da cannabis (FISAR, 2009; MACCARRONE, 2020). 11 Figure 1. Vias de síntese e degradação dos endocanabinóides. A síntese e degradação do endocanabinóide Anandamida ocorre no citoplasma do neurônio pós-sináptico, sendo evidenciada pela enzima de síntese N-acil fosfatidiletanolamine fosfolipase D (NAPE- PDL) e degradação amida hidrolase de ácidos graxos (FAAH). A síntese do endocanabinóide 2-Aracdonoilglicerol (2-AG) ocorre na membrana plasmática do neurônio pós-sináptico por meio da enzima diacilglicerol (DAGL), enquanto a sua degradação se dá no citoplasma do neurônio pré-sináptico pela enzima lipase de monoacilglicerol (MAGL). (MARZO; BIFULCO; PETROCELLIS, 2014). 1.2.4 Canabidiol O canabidiol (CBD) é o principal componente não-psicoativo encontrado na Cannabis sativa (MECHOULAM et al., 2007). O CBD apresenta baixa afinidade pelos receptores 12 CB1 e CB2, podendo se comportar como antagonista ou agonista inverso a depender da concentração tecidual destes receptores e da sua interação com outras substâncias e receptores não canabinóides locais (THOMAS et al., 2007; PERTWEE, 2008). Apresenta também mecanismos de ação não-dependentes de receptores CB1 e CB2, se ligando a receptores transitório vanilóide tipo I (TRPV1) e atuando em diversas vias de sinalização com o intuito de amenizar ou impedir a ativação da resposta imune e a produção de moléculas pró-inflamatórias, como o fator de transcrição (STAT) e proteínas quinase ativadas por mitógeno (MAPK) (LIBRO et al., 2016; PEYRAVIAN et al., 2020) A capacidade anti-inflamatória do CBD quando cultivado com células-tronco de gengiva humana já foi demonstrada, o que ocorreu devido à redução da expressão de proteínas, citocinas e genes relacionados à atividade pró-inflamatória, como IL-1ß, IL-6, IFN-ɣ e via de sinalização dependente de NF-κB (LIBRO et al., 2016). Em equinos, o seu potencial antiinflamatório foi evidenciado apenas quando cultivado junto a células mononucleares de sangue periférico, sendo observada a redução na expressão dos genes pró-inflamatórios TNF-ɑ e INF-γ (TURNER; BARKER; ADAMS, 2021). O CBD já provou eficiente ação neuroprotetora em modelos experimentais de doenças neurodegenerativas como Parkinson, Alzheimer e esclerose lateral amiotrófica (ELA) (LIBRO et al., 2016). Esta capacidade neuroprotetora e de redução da neuroinflamação se deu por meio da inibição da apoptose neuronal, inibição da ativação dos canais de cálcio celulares, modificação da micróglia para seu fenótipo antiinflamatório (M2) e aumento da expressão de receptores CB2 e da enzima responsável pela síntese de AEA (MORENO‐ MARTET et al., 2014; LIBRO et al., 2016). Ainda seu potencial neurotrófico já foi evidenciado in vivo, o qual foi atribuído principalmente à sua afinidade com os sítios de ligação de fatores neurotróficos, promovendo a ativação das vias de sinalização semelhantemente ao que ocorre após estimulação com seus respectivos agonistas (SANTOS et al., 2015). 13 1.2.5 Células Tronco Mesenquimais O potencial terapêutico das células-tronco mesenquimais (CTM) é tema de constante estudo na espécie equina, tendo sido relatada sua eficácia no tratamento de afecções articulares, tendíneas, ósseas, reprodutivas, inflamatórias, neurológicas entre outras nesta espécie (GUGJOO et al., 2019; MACDONALD; BARRETT, 2020). Tais estudos se baseiam na capacidade proliferativa, imunomodulatória e de diferenciação das CTM o que, por outro lado, estimula cada vez mais o entendimento do seu modo de ação e os benefícios que podem trazer frente a diversas doenças nesta espécie (HWANG et al., 2009; CORTÉS- ARAYA et al., 2018; WANG et al., 2020). A identificação das CTM equinas, feita com base nos critérios mínimos definidos pela International Society for Cell & Gene Therapy (ISCT) e levando em consideração as particularidades de cada espécie e tecido, se dá pelas suas características de aderência ao plástico, capacidade de diferenciação nas linhagens adipogênica, condrogênica e osteogênica in vitro e a expressão positiva de marcadores de superfície CD29, CD44, CD90 e CD105 e negativa de CD14, CD34, CD45, CD79ɑ e MHC II (DOMINICI et al., 2006; CARRADE et al., 2012; CARRADE; BORJESSON , 2013; BARBERINI et al., 2014). As CTM podem ser obtidas de uma variedade de tecidos, como medula óssea (CTM- MO), tecido adiposo (CTM-AT), sangue de cordão umbilical (CTM-CU), tecido de cordão umbilical (CTM-TU), placenta (CTM-PL), entre outros, e características inerentes à população celular de cada tecido, como facilidade de obtenção e isolamento, potencial imunomodulatório, proliferativo e de diferenciação acabam influenciando na escolha das CTM a serem utilizadas (LEE et al., 2012; CARRADE; BORJESSON, 2013; JIN et al., 2013; BARBERINI et al., 2014; HAO et al., 2017). 1.2.5.1 Ativação das Células Tronco Mesenquimais A capacidade imunomodulatória das CTM se mostra dependente da presença de um ambiente inflamatório, visto que CTM cultivadas em meios que careciam de estímulos inflamatórios apresentaram uma menor influência na taxa de proliferação linfocitária e na 14 liberação de fatores anti-inflamatórios in vitro quando comparadas às CTM cultivadas em ambientes inflamatórios (CARRADE et al., 2012). O LPS se trata de uma molécula presente na membrana celular externa de bactérias gram-negativas, sendo utilizado como agonista dos receptores toll-like 4 (TLR4) (BETTONI et al., 2008). A ativação destes receptores ocorre por meio da sua ligação com estruturas conhecidas como Padrões Moleculares Associados a Danos (DAMPs) e Padrões Moleculares Associados a Patógenos (PAMPs), os quais se encontram presentes em grande quantidade durante afecções de carácter inflamatório ou infeccioso, respectivamente (IANNOTTA et al., 2021). Dentre os modelos inflamatórios atualmente utilizados, a ativação dos receptores toll- like 4 (TLR4) desempenham um importante papel no reconhecimento e início da resposta imune inata e adquirida (BETTONI et al., 2008). Ainda, o uso de seus agonistas, dentre eles o LPS, é utilizado como modelo de estudo de diversas afecções de caráter inflamatório e infeccioso in vivo e in vitro (HU et al., 2016; MARTIN et al., 2017). 1.2.5.2 Participação das Células Tronco Mesenquimais na regeneração nervosa As CTM representam uma valiosa opção no tratamento de lesões nervosas periféricas, fato este decorrente de características conhecidas destas células como capacidade de diferenciação em células de linhagens gliais, produção de fatores neurotróficos e angiogênicos e modulação da resposta inflamatória local (AUDETTE et al., 2013; TOMITA et al., 2013; CORTÉS-ARAYA et al., 2018; CAILLAUD et al., 2019; LI et al., 2022). O potencial de diferenciação das CTM-TA humanas em células produtoras de mielina já foi demonstrado in vivo, enquanto o mesmo grupo evidenciou a produção de fatores neurotróficos BDNF, NGF e GDNF em CTM-TA humanas diferenciadas em células Schwann-like in vitro (TOMITA et al., 2013). Quanto ao seu potencial imunomodulador e angiogênico, modelos in vitro e in vivo demonstraram a capacidade das CTM em produzir fatores angiogênicos, como o fator de crescimento endotelial vascular (VEGF), de promover a redução da produção de moléculas 15 pró-inflamatórias, como IL-6, TNF-ɑ, IL-ß e GM-CSF pelas células imunes locais, além de aumentar a liberação de citocinas com potencial anti-inflamatório, como IL-10 e TGF-ß pelos macrófagos (OMI et al., 2016; LI et al., 2022) 1.3 HIPÓTESE A hipótese deste estudo é de que as CTM-TA equinas, quando cultivadas com extrato de Cannabis sativa rico em canabidiol, apresentam aumento do seu potencial imunomodulatório e neuroregenerativo. 1.4 OBJETIVOS 1.4.1 Objetivo geral Analisar o potencial anti-inflamatório e neurotrófico do extrato rico em canabidiol, derivado da planta Cannabis sativa, sobre células-tronco mesenquimais equinas derivadas de tecido adiposo in vitro. 1.4.2 Objetivos específicos  Analisar a taxa de viabilidade e proliferação das CTM-TA equinas nos seis grupos experimentais: Grupo controle (CTM-TA), Grupo veículo (CTM-TA + 0,05% DMSO) e grupos tratados com extrato rico em canabidiol nas doses de 3 µM (CTM-TA + CBD 3 µM), 5 µM (CTM-TA + CBD 5 µM), 7 µM (CTM-TA + CBD 7 µM) e 9 µM (CTM-TA + CBD 9 µM) por meio do teste do MTT (sal de tetrazólio) nos períodos de 24 e 48 horas;  Analisar, por meio de técnica de qPCR, a expressão das citocinas INF-ɤ, TNF-ɑ, IL-1ß, IL-6 e IL-10 e das neurotrofinas NGF, BDNF e GDNF nas CTM-TA equinas estimuladas com LPS nos seis grupos experimentais: Grupo controle (CTM-TA), Grupo estimulado com LPS (CTM-TA + 10 ng/ml LPS), Grupo veículo (CTM-TA + LPS + 0,05% DMSO) e grupos estimulados e tratados extrato rico em canabidiol nas doses de 3 16 µM (CTM-TA + 10 ng/ml LPS + CBD 3 µM), 5 µM (CTM-TA + 10 ng/ml LPS + CBD 5 µM) e 7 µM (CTM-TA + 10 ng/ml LPS + CBD 7 µM) nos períodos de 24 e 48 horas; 1.5 Referências AAMAR, S.; SAADA, A.; ROTSHENKER, S. Lesion‐induced changes in the production of newly synthesized and secreted apo‐E and other molecules are independent of the concomitant recruitment of blood‐borne macrophages into injured peripheral nerves. Journal of neurochemistry, v. 59, n. 4, p. 1287-1292, 1992. AUDETTE, R.V.; LAVOIE-LAMOUREUX, A.; LAVOIE, J.P.; LAVERTY, S. Inflammatory stimuli differentially modulate the transcription of paracrine signaling molecules of equine bone marrow multipotent mesenchymal stromal cells. Osteoarthritis and Cartilage, v. 21, n. 8, p. 1116-1124, 2013. BARBERINI, D.J.; FREITAS, N.P.P.; MAGNONI, M.S.; MAIA, L.; LISTONI, A.J.; HECKLER, M.C.; SUDANO, M.J.; GOLIM, M.A.; LANDIM-ALVARENGA, F.C.; AMORIM, R.M. Equine mesenchymal stem cells from bone marrow, adipose tissue and umbilical cord: immunophenotypic characterization and differentiation potential. Stem cell research & therapy, v. 5, n. 1, p. 1-11, 2014. BATTISTA, N.; TOMMASO, M.D.; BARI, M.; MACCARRONE, M. The endocannabinoid system: an overview. Frontiers in behavioral neuroscience, v. 6, p. 9, 2012. BETTONI, I.; COMELLI, F.; ROSSINI, C.; GRANUCCI, F.; GIAGNONI, G.; PERI, F.; COSTA, B. Glial TLR4 receptor as new target to treat neuropathic pain: efficacy of a new receptor antagonist in a model of peripheral nerve injury in mice. Glia, v. 56, n. 12, p. 1312-1319, 2008. BOORMAN, S.; SCHERRER, N.M.; STEFANOVSKI, D.; JOHNSON, A.L. Facial nerve paralysis in 64 equids: Clinical variables, diagnosis, and outcome. Journal of veterinary internal medicine, v. 34, n. 3, p. 1308-1320, 2020. BURNETT, M.G.; ZAGER, E.L. Pathophysiology of peripheral nerve injury: a brief review. Neurosurgical focus, v. 16, n. 5, p. 1-7, 2004. CAILLAUD, M.; RICHARD, L.; VALLAT, J.M.; DESMOULIÈRE, AL.; BILLET, F. Peripheral nerve regeneration and intraneural revascularization. Neural regeneration research, v. 14, n. 1, p. 24, 2019. CARLINI, E.A. A história da maconha no Brasil. Jornal brasileiro de psiquiatria, v. 55, p. 314-317, 2006. 17 CARLINI, E. A.; KRAMER, C. Effects of Cannabis sativa (marihuana) on maze performance of the rat. Psychopharmacologia, v. 7, n. 3, p. 175-181, 1965. CARRADE, D.D.; LAME, M.W.; KENT, M.S.; CLARK, K.C.; WALKER, N.J.; BORJESSON, D.L. Comparative analysis of the immunomodulatory properties of equine adult-derived mesenchymal stem cells. Cell medicine, v. 4, n. 1, p. 1-12, 2012. CARRADE, D.D.; BORJESSON, D.L. Immunomodulation by mesenchymal stem cells in veterinary species. Comparative medicine, v. 63, n. 3, p. 207-217, 2013. CLARK, A.K.; OLD, E.A.; MALCANGIO, M. Neuropathic pain and cytokines: current perspectives. Journal of pain research, v. 6, p. 803, 2013. COORAY, R.; GUPTA, V.; SUPHIOGLU, C. Current aspects of the endocannabinoid system and targeted THC and CBD phytocannabinoids as potential therapeutics for Parkinson’s and Alzheimer’s diseases: a review. Molecular Neurobiology, v. 57, n. 11, p. 4878-4890, 2020. CORTÉS-ARAYA, Y.; AMILON, K.; RINK, B.E.; BLACK, G.; LISOWSKI, Z.; DONADEU, F.X.; ESTEVES, A.L. Comparison of antibacterial and immunological properties of mesenchymal stem/stromal cells from equine bone marrow, endometrium, and adipose tissue. Stem Cells and Development, v. 27, n. 21, p. 1518-1525, 2018. CRUZ, A.J.M.; DE JESUS, O. Neurotmesis. In: StatPearls [Internet]. StatPearls Publishing, 2021. DA SILVA, C. K.; CAMARGO, E. A. Mecanismos envolvidos na regeneração de lesões nervosas periféricas. Saúde e Pesquisa, v.3, n.1, 2010. DE LAHUNTA, A.; GLASS, E.; KENT, M. Lower Motor Neuron: General Somatic Efferent, Cranial Nerve. In: Veterinary Neuroanatomy and Clinical Neurology. 4 ed. St. Louis: Elsevier, 2015. p. 162-196. DEVANE, W.A.; DYSARZ, F.A.; JOHNSON, M.R.; MELVIN, L.S.; HOWLETT, A.C. Determination and characterization of a cannabinoid receptor in rat brain. Molecular pharmacology, v. 34, n. 5, p. 605-613, 1988. DEVANE, W.A.; HANUS, L.; BREUER, A.; PERTWEE, R.G.; STEVENSON, L.A.; GRIFFIN, G.; GIBSON, D.; MANDELBAUM, A.; ETINGER, A; MECHOULAM, R. Isolation and structure of a brain constituent that binds to the cannabinoid receptor. Science, v. 258, n. 5090, p. 1946-1949, 1992. DOMINICI, M.L.B.K.; LE BLANC, K.; MUELLER, I.; SLAPER-CORTENBACH, I.; MARINI, F.C.; KRAUSE, D.S.; DEANS, R.J.; KEATING, A.; PROCKOP, D.J.; HORWITZ, E.M. Minimal criteria for defining multipotent mesenchymal stromal cells. 18 The International Society for Cellular Therapy position statement. Cytotherapy, v. 8, n. 4, p. 315-317, 2006. FISAR, Z. Phytocannabinoids and endocannabinoids. Current drug abuse reviews, v. 2, n. 1, p. 51-75, 2009. GAONI, Y.; MECHOULAM, R. Isolation, structure, and partial synthesis of an active constituent of hashish. Journal of the American chemical society, v. 86, n. 8, p. 1646- 1647, 1964. GUGJOO, M.B.; AMARPAL; MAKHDOOMI, D.M.; SHARMA, G.T. Equine mesenchymal stem cells: properties, sources, characterization, and potential therapeutic applications. Journal of equine veterinary science, v. 72, p. 16-27, 2019. GRIFFIN, J.W.; THOMPSON, W.J. Biology and pathology of nonmyelinating Schwann cells. Glia, v. 56, n. 14, p. 1518-1531, 2008. GRINSELL, D.; KEATING, C. P. Peripheral nerve reconstruction after injury: a review of clinical and experimental therapies. BioMed research international, v. 2014, 2014. HAO, T.; CHEN, J.; ZHI, S; ZHANG, Q.; CHEN, G.; YU, F. Comparison of bone marrow-vs. adipose tissue-derived mesenchymal stem cells for attenuating liver fibrosis. Experimental and therapeutic medicine, v. 14, n. 6, p. 5956-5964, 2017. HU, Y.; QIN, C.; ZHENG, G.; LAI, D.; TAO, H.; ZHANG, Y.; QIU, G.; GE, M.; HUANG, L.; CHEN, L.; CHENG, B.; SHU, Q.; XU, J. Mesenchymal stem cell-educated macrophages ameliorate LPS-induced systemic response. Mediators of inflammation, v. 2016, 2016. HWANG, Nathaniel S. et al. Mesenchymal stem cell differentiation and roles in regenerative medicine. Wiley Interdisciplinary Reviews: Systems Biology and Medicine, v. 1, n. 1, p. 97-106, 2009. IANNOTTA, M.; BELARDO, C.; TROTTA, M.C.; IANNOTTI, F.A.; VITALE, R.M.; MAISTO, R.’BOCCELLA, S.; INFANTINO, R.’RICCIARDI, F.; MIRTO, B.F.; FERRERECCIO, F.; PANARESE, I.; AMODEO, P.; TUNISI, L.; CRISTINO, L.; D’AMICO, M.; DI MARZO, V.; LUONGO, L.; MAIONE, S.; GUIDA, F. N-palmitoyl-D- glucosamine, a natural monosaccharide-based glycolipid, inhibits TLR4 and prevents LPS- induced inflammation and neuropathic pain in mice. International journal of molecular sciences, v. 22, n. 3, p. 1491, 2021. JIN, H.J.; BAE, Y.K.; KIM, M.; KWON, S.J.; JEON, H.B.; CHOI, S.J.; KIN, S.W.; YANG, Y.S., OH, W.; CHANG, J.W. Comparative analysis of human mesenchymal stem cells from bone marrow, adipose tissue, and umbilical cord blood as sources of cell therapy. International journal of molecular sciences, v. 14, n. 9, p. 17986-18001, 2013. 19 KAMBLE, N.; SHUKLA, D.; BHAT, D. Peripheral nerve injuries: electrophysiology for the neurosurgeon. Neurology India, v. 67, n. 6, p. 1419, 2019. LEE, J.M.; JUNG, J.; LEE, H.J.; JEONG, S.J.; CHO, K.J.; HWANG, S.G.; KIM, G.J. Comparison of immunomodulatory effects of placenta mesenchymal stem cells with bone marrow and adipose mesenchymal stem cells. International immunopharmacology, v. 13, n. 2, p. 219-224, 2012. LEHMANN, H.C.; WUNDERLICH, G.; FINK, G.R.; SOMMER, C. Diagnosis of peripheral neuropathy. Neurological research and practice, v. 2, n. 1, p. 1-7, 2020. LI, X.; GUAN, Y.; LI, C.; ZHANG, T.; MENG, F.; ZHANG, J.; LI, J.; CHEN, S.; WANG, Q.; WANG, Y.; PENG, J.; TANG, J. Immunomodulatory effects of mesenchymal stem cells in peripheral nerve injury. Stem Cell Research & Therapy, v. 13, n. 1, p. 1-13, 2022. LIBRO, R.; SCIONTI, D.; DIOMEDE, F.; MARCHISIO, M.; GRASSI, G.; POLLASTRO, F.; PIATTELLI, A.; BRAMANTI, P.; MAZZON, E.; TRUBIANI, O. Cannabidiol modulates the immunophenotype and inhibits the activation of the inflammasome in human gingival mesenchymal stem cells. Frontiers in physiology, v. 7, p. 559, 2016. LIGRESTI, A.; PETROSINO, S.; DI MARZO, V. From endocannabinoid profiling to ‘endocannabinoid therapeutics’. Current opinion in chemical biology, v. 13, n. 3, p. 321- 331, 2009. LIU, Q.; WANG, X.; YI, S. Pathophysiological changes of physical barriers of peripheral nerves after injury. Frontiers in neuroscience, v. 12, p. 597, 2018. MACCARRONE, M. Phytocannabinoids and endocannabinoids: different in nature. Rendiconti Lincei. Scienze Fisiche e Naturali, v. 31, n. 4, p. 931-938, 2020. MACDONALD, E.S.; BARRETT, J.G. The potential of mesenchymal stem cells to treat systemic inflammation in horses. Frontiers in Veterinary Science, v. 6, p. 507, 2020. MARCHALANT, Y.; CERBAI, F.; BROTHERS, H.M.; WENK, G.L. Cannabinoid receptor stimulation is anti-inflammatory and improves memory in old rats. Neurobiology of aging, v. 29, n. 12, p. 1894-1901, 2008. MARTIN, E.M.; MESSENGER, K.M.; SHEATS, M.K.; JONES, S.L. Misoprostol inhibits lipopolysaccharide-induced pro-inflammatory cytokine production by equine leukocytes. Frontiers in Veterinary Science, v. 4, p. 160, 2017. MARZO, V.D.; BIFULCO, M.; PETROCELLIS, L.D. The endocannabinoid system and its therapeutic exploitation. Nature reviews Drug discovery, v. 3, n. 9, p. 771-784, 2004. MECHOULAM, R.; SHVO, Y. Hashish. I: the structure of cannabidiol. Tetrahedron, v. 19, n. 12, p. 2073-2078, 1963. 20 MECHOULAM, R.; PETERS, M.; MURILLO-RODRIGUEZ, E.; HANUš, L.O. Cannabidiol–recent advances. Chemistry & biodiversity, v. 4, n. 8, p. 1678-1692, 2007. MECHOULAM, R.; BEN-SHABAT, S.; HANUS, L; LIGUMSKY, M.; KAMINSKI, N.E.; SCHATZ, A.R.; GOPHER, A.; ALMOG, S.; MARTIN, B.R.; COMPTON, D.R.; PERTWEE, R.G.; GRIFFIN, G.; BAYEWITCH, M.; BARG, J.; VOGEL, Z. Identification of an endogenous 2-monoglyceride, present in canine gut, that binds to cannabinoid receptors. Biochemical pharmacology, v. 50, n. 1, p. 83-90, 1995. MENORCA, R.M.G; FUSSELL, T.S.; ELFAR, J.C. Nerve physiology: mechanisms of injury and recovery. Hand clinics, v. 29, n. 3, p. 317-330, 2013. MORENO‐MARTET, M.; ESPEJO-PORRAS, F.; FERNÁNDEZ-RUIZ, J.; LAGO, E. Changes in Endocannabinoid Receptors and Enzymes in the Spinal Cord of SOD 1G93A Transgenic Mice and Evaluation of a Sativex®‐like Combination of Phytocannabinoids: Interest for Future Therapies in Amyotrophic Lateral Sclerosis. CNS neuroscience & therapeutics, v. 20, n. 9, p. 809-815, 2014. MUNRO, S.; THOMAS, K.L.; ABU-SHAAR, M. Molecular characterization of a peripheral receptor for cannabinoids. Nature, v. 365, n. 6441, p. 61-65, 1993. OMI, M.; HATA, M.; NAKAMURA, N.; MIYABE, M.; KOBAYASHI, Y.; KAMIYA, H.; NAKAMURA, J.; OZAWA, S.; TANAKA, Y.; TAKEBE, J.; MATSUBARA, T.; NARUSE, K. Transplantation of dental pulp stem cells suppressed inflammation in sciatic nerves by promoting macrophage polarization towards anti‐inflammation phenotypes and ameliorated diabetic polyneuropathy. Journal of diabetes investigation, v. 7, n. 4, p. 485- 496, 2016. OSAWA, T.; FENG, X.Y.; LIAO, M.Y.; MORIGUZHI, K. Collagen fibrils in the peripheral nerves. Connective tissue, v. 31, n. 4, p. 235-241, 1999. PACHER, P.; BÁTKAI, S.; KUNOS, G. The endocannabinoid system as an emerging target of pharmacotherapy. Pharmacological reviews, v. 58, n. 3, p. 389-462, 2006. PANDEY, S.; MUDGAL, J. A review on the role of endogenous neurotrophins and schwann cells in axonal regeneration. Journal of Neuroimmune Pharmacology, p. 1-11, 2021. PEITERSEN, E. Bell's palsy: the spontaneous course of 2,500 peripheral facial nerve palsies of different etiologies. Acta oto-laryngologica, v. 122, n. 7, p. 4-30, 2002. PEREIRA, T.; GäRTNER, A.; AMORIM, I.; ALMEIDA, A.; CASEIRO, A.R.; ARMADA-DA-SILVA, P.A.S.; AMADO, S.; FREGNAN, F.; VAREJÃO, A.S.P.; SANTOS, J.D.; BARTOLO, P.J.; GEUNA, S; LUÍS, AL.L; MAURICIO, A.C. Promoting nerve regeneration in a neurotmesis rat model using poly (DL-lactide--caprolactone) https://onlinelibrary.wiley.com/action/doSearch?ContribAuthorRaw=Hanu%C5%A1%2C+Lum%C3%ADr+O 21 membranes and mesenchymal stem cells from the Wharton’s jelly: in vitro and in vivo analysis. BioMed research international, v. 2014, 2014. PERTWEE, R.G. The diverse CB1 and CB2 receptor pharmacology of three plant cannabinoids: Δ9‐tetrahydrocannabinol, cannabidiol and Δ9‐ tetrahydrocannabivarin. British journal of pharmacology, v. 153, n. 2, p. 199-215, 2008. PEYRAVIAN, N.; DEO, S.; DAUNERT, S.; JIMENEZ, J.J. Cannabidiol as a novel therapeutic for immune modulation. ImmunoTargets and therapy, v. 9, p. 131, 2020. RODRIGUES, R.S.; LOURENÇO, D.M.; PAULO, S.L.; MATEUS, J.M.; FERREIRA, M.F.; MOURO, F.M.; MOREIRA, J.B.; RIBEIRO, F.F.; SEBASTIÃO, A.M.; XAPELLI, S. Cannabinoid actions on neural stem cells: implications for pathophysiology. Molecules, v. 24, n. 7, p. 1350, 2019. RODRÍGUEZ DE FONSECA, F.; DEL ARCO, I.; BERMUDEZ-SILVA, F.J.; BILBAO, A.; CIPPITELLI, A.; NAVARRO, M. The endocannabinoid system: physiology and pharmacology. Alcohol and Alcoholism, v. 40, n. 1, p. 2-14, 2005. ROTSHENKER, S. Wallerian degeneration: the innate-immune response to traumatic nerve injury. Journal of neuroinflammation, v. 8, n. 1, p. 1-14, 2011. SAADA, A.; DUNAEVSKY-HUTT, A.; AAMAR, A.; REICHERT, F.; ROTSHENKER, S. Fibroblasts that reside in mouse and frog injured peripheral nerves produce apolipoproteins. Journal of neurochemistry, v. 64, n. 5, p. 1996-2003, 1995. SANCHEZ, D. N. R.; BERTANHA, M.; FERNANDES, T. D.; DE LIMA RESENDE, L. A.; DEFFUNE, E.; AMORIM, R. M. Effects of canine and murine mesenchymal stromal cell transplantation on peripheral nerve regeneration. International journal of stem cells. v.10, n.83, 2017. SANTOS, N.A.G.; MARTINS, N.M.; SISTI, F.M.; FERNANDES, L.S.; FERREIRA, R.S.; QUEIROZ, R.H.C.; SANTOS, A.C. The neuroprotection of cannabidiol against MPP+- induced toxicity in PC12 cells involves trkA receptors, upregulation of axonal and synaptic proteins, neuritogenesis, and might be relevant to Parkinson's disease. Toxicology in Vitro, v. 30, n. 1, p. 231-240, 2015. SEDDON, H.J. Three types of nerve injury. Brain, v. 66, n. 4, p. 237-288,1943. SHAMASH, S.; REICHERT, F.; ROTSHENKER, S. The cytokine network of Wallerian degeneration: tumor necrosis factor-alpha. In: interleukin-1alpha, and interleukin-1beta. J Neurosci. 2002; 22: 3052–60. SILVER, R. The Endocannabinoid System and Endocannabinoidome. In: Cannabis Therapy in Veterinary Medicine. Springer, Cham, 2021. p. 1-16. 22 SUNDERLAND, S. A classification of peripheral nerve injuries producing loss of function. Brain, v. 74, n. 4, p. 491-516, 1951. THOMAS, A.; BAILLIE, G.L.; PHILLIPS, A.M.; RAZDAN, R.K.; ROSS, R.A.; PERTWEE, R.G. Cannabidiol displays unexpectedly high potency as an antagonist of CB1 and CB2 receptor agonists in vitro. British journal of pharmacology, v. 150, n. 5, p. 613- 623, 2007. TOMITA, K.; MADURA, T.; SAKAI, Y.; YANO, K.; TERENGHI, G.; HOSOKAWA, K. Glial differentiation of human adipose-derived stem cells: implications for cell-based transplantation therapy. Neuroscience, v. 236, p. 55-65, 2013. TURNER, S.; BARKER, V.D.; ADAMS, A.A. Effects of cannabidiol on the in vitro lymphocyte pro-inflammatory cytokine production of senior horses. Journal of equine veterinary science, v. 103, p. 103668, 2021. UBOGU, E.E. The molecular and biophysical characterization of the human blood-nerve barrier: current concepts. Journal of vascular research, v. 50, n. 4, p. 289-303, 2013. UDINA, E.; COBIANCHI, S.; ALLODI, I.; NAVARRO, X. Effects of activity-dependent strategies on regeneration and plasticity after peripheral nerve injuries. Annals of Anatomy-Anatomischer Anzeiger, v. 193, n. 4, p. 347-353, 2011. VERHEIJEN, M.H.G.; CHRAST, R.; BURROLA, P.; LEMKE, G. Local regulation of fat metabolism in peripheral nerves. Genes & development, v. 17, n. 19, p. 2450-2464, 2003. WANG, J.; HU, W.W.; JIANG, Z.; FENG, M.J. Advances in treatment of neurodegenerative diseases: perspectives for combination of stem cells with neurotrophic factors. World Journal of Stem Cells, v. 12, n. 5, p. 323, 2020. WONG, H.; CAIRNS, B.E. Cannabidiol, cannabinol and their combinations act as peripheral analgesics in a rat model of myofascial pain. Archives of oral biology, v. 104, p. 33-39, 2019. ZUARDI, A.W. History of cannabis as a medicine: a review. Brazilian Journal of Psychiatry, v. 28, p. 153-157, 2006. 23 Capítulo 2 Este trabalho será submetido ao periódico “Cannabis and Cannabinoid Research” (Fator de impacto 4.786 – JCR 2021). Guias para submissão de artigos: https://home.liebertpub.com/publications/633/pdf 1.6 Trabalho científico Cannabidiol-rich extract suppress the activation of proinflammatory genes Interleukin-1ß and Interleukin-6 in equine mesenchymal stem cells stimulated with lipopolysaccharide Beatriz da Costa Kamura1; Lucas Vinícius de Oliveira Ferreira1, Natielly Dias Chimenes1, João Pedro Marmol de Oliveira1, Diego Noé Rodriguéz Sanchéz2, Márcio de Carvalho3, Rogério Martins Amorim1 1 Laboratory – Translational Center for Regenerative Medicine (NUTRAMERE), Department of Veterinary Medicine, Faculty of Veterinary Medicine and Animal Science, São Paulo State University – UNESP, campus Botucatu, São Paulo, Brazil. 2 Laboratory of Nerve Regeneration, Department of Anatomy, University of Campinas – UNICAMP, Campinas, São Paulo, BR. 3 Department of Veterinary Clinic, School of Veterinary Medicine and Animal Science, São Paulo State University - UNESP, campus Botucatu, São Paulo, Brazil. SUMARY Introduction: Injuries to the peripheral nervous system, especially those of greater severity and comprising a longer gap, often result in sequels or impaired function. Therapies aimed at restoring an environment that supports regeneration and stimulating tissue repair often prove to be beneficial for a satisfactory recovery. Anti-inflammatory and neuroprotective potential of mesenchymal stem cells (MSCs) and cannabidiol (CBD), when associated, may assist in the treatment of peripheral neuropathies. Therefore, we tested the in vitro ability of https://home.liebertpub.com/publications/633/pdf 24 CBD to promote and stimulate equine Ad-MSCs to express genes related to its anti- inflammatory and neurotrophic potential in an inflammatory environment. Materials and Methods: MSC from the laboratory cell bank and previously characterized were used. Adipose derived MSCs from four different animals were separated into six experimental groups and incubated for 24 and 48 hours. Cell metabolic activity was analyzed using the MTT test, being performed on equine Ad-MSCs submitted to six different treatments: complete culture medium, vehicle of 0,05% DMSO and CBD at doses of 3 µM, 5 µM, 7 µM and 9 µM. According to the result of metabolic activity, analysis of gene expression was performed in experimental groups of Ad-MSCs submitted to six different treatments: 10ng/ml LPS, 10ng/ml LPS + vehicle 0,05% and Ad-MSCs stimulated with 10ng/ml LPS and treated with CBD at doses of 3 µM, 5 µM and 7 µM. Results: The viability of equine MSCs was reduced only when cultivated with the extract rich in cannabidiol at a dose of 9µM for a period of 24 hours. It was possible to notice the reduction in the expression of genes related to the pro-inflammatory cytokines IL-6 (P<0.001) and IL-1ß (P<0.05) and neurotrophin NGF (P<0.001), while other genes related to IL-10, IFN-ɣ, TNF-ɑ, BDNF e GDNF showed no significant alteration. Conclusion: Treatment of equine Ad-MSCs with cannabidiol-rich extract is capable of increase its immunomodulatory capacity without interfering with their metabolic activity in vitro. Also, the lack of influence on the secretion of neurotrophic factors by equine MSCs in vitro might be a consequence of its direct action on receptor and signaling pathways rather than regulation of these neurotrophins. Keywords: Cannabis, cell therapy, immunomodulation, neuroregeneration, neurotrophins. INTRODUCTION In humans, traumatic peripheral neuropathies have an annual incidence of 45 cases per 100,000 inhabitants resulting in motor, sensory and autonomic loss that negatively affect quality of life.1,2 In the equine species, traumatic nerve injuries are one of the most commom types lesion affecting peripheral nerve system, which can make its study in this species an important experimental model for the traumatic injuries that occur in humans.3 25 Mesenchymal stem cells have the ability to proliferate, differentiate into cells of glial lineages, immunomodulation and secretion of neurotrophic factors, having been demonstrated as a potential tool in the treatment of lesions that affect the peripheral nervous system.4–9 As an adjuvant, research carried out in vitro and in vivo has demonstrated the ability of the compound derived from Cannabis sativa, cannabidiol (CBD), to aid in the treatment of diseases that affect the central and peripheral nervous system.10–12 After peripheral nerve injuries, several cellular and molecular events begin with the aim of promoting axonal regeneration and reinnervation of the target tissue.13 In the early stages of peripheral nerve injury, increased production of inflammatory cytokines IL-1ß, IL-6, TNF-ɑ and IFN-ɣ is promoted by Schwann cells, macrophages and local defense cells, with the aim of recruitment of immune cells and phagocytosis of cellular debris.9 The reduction in the production of IL-1ß and TNF-ɑ occurs concomitantly with the arrival of macrophages at the lesion site, which are polarized for its anti-inflammatory phenotype (M2), secreting a greater amount of IL-6 and IL-10.14,15 Concurrently with the removal of cellular debris, led by macrophages and Schwann cells, the Schwann cells themselves initiate the secretion of several neurotrophic factors such as nerve growth factor (NGF), a brain-derived neurotrophic factor (BDNF), glial-derived neurotrophic factor (GDNF) and neurotrophin-3 (NT-3).6,8,16 The anti-inflammatory capacity of CBD when cultivated with human gingival stem cells has already been demonstrated, which occurred due to the reduction in the expression of proteins, cytokines and genes related to pro-inflammatory activity.17 CBD has already proven efficient neuroprotective action in experimental models of neurodegenerative diseases such as Parkinson's, Alzheimer's and amyotrophic lateral sclerosis (ALS) through inhibition of neuronal apoptosis, modification of microglial macrophages to their anti- inflammatory phenotype (M2) and increased expression of CB2 receptors.17,18 Its neurotrophic potential has already been demonstrated in vivo, which was mainly attributed to its affinity with the binding sites of neurotrophic factors and promoting the activation of signaling pathways similarly to what occurs after stimulation with their respective agonists.19 Therefore, the aim of this work was to investigate the anti-inflammatory and 26 neurotrophic potential in vitro of the cannabidiol-rich extract in equine adipose derived mesenchymal stem cells stimulated with LPS. MATERIAL AND METHODS Equine mesenchymal stem cells used Adipose derived Equine mesenchymal stem cells (Ad-MSCs) in 3rd passage (P3) were obtained from the equine MSC bank belonging to the Large Animal Internal Medicine of UNESP – Botucatu/SP. Previously collected from healthy animals as approved by the Ethics Committee on Animal Use of Unesp in Botucatu (Protocol 178/2011-CEUA), equine MSCs were isolated and previously characterized.20 MSCs showed potential of differentiation in adipogenic, chondrogenic and osteogenic lineages, adhesion to the plastic surface and characteristic surface markers. The cells used were thawed and cultured in culture medium composed of 90% Dulbecco's Modified Eagle's Medium (DMEM, Nova Biotecnologia, Brazil), 10% Fetal bovine serum (SFB, Nova Biotecnologia) and 1% Penicillin and Streptomycin (Gibco®) until reaching 80% confluence. Cannabidiol-rich extract The cannabidiol-rich extract was extracted from the Cannabis sativa L. plant and analyzed using the High Performance Liquid Chromatography (HPLC) method by the company DALL Soluções Analíticos e Empresariais, which was obtained by Associação Alternativa (Imbituba, Santa Catarina) (Supplementary material - Appendix 1). A stock solution of 25 mg/ml was prepared diluted in the vehicle dimethylsulfoxide (DMSO), being used during the course of the study. Analysis of cellular metabolic activity Prior to gene analysis and expression, MSCs were transferred to a 96-well plate (Sarstedt, Nümbrecht, Germany) in duplicates at a density of 104 cells/well (103cells/cm2). 27 After 24 h, the supernatant was discarded and replaced by culture medium with 10% FBS (control), culture medium with 10% FBS and 0.05% DMSO (DMEM with vehicle) and CBD at concentrations of 3, 5, 7 and 9 µM in the treated groups, for a period of 24 and 48 hours. At the end of the treatment, the medium was removed and the MSCs incubated in MTT (3-(4,5-dimethylthiazol-2yl)-2,5-diphenyl tetrazoline bromide) solution for 4 hours at 37°C and 5 %CO2. After removing the MTT solution, the cells were homogenized with 200µl of DMSO and analyzed at absorbance of 570 nm in an Asys Expert Plus® microplate reader (BioChrom). Gene expression of cytokines and neurotrophic factors After performing the analysis of metabolic activity, gene expression of cytokines (INF-ɣ, TNF-ɑ, IL-1ß, IL-6 and IL-10) and neurotrophic factors (NGF, BDNF and GDNF) was quantified using the qPCR technique. For this, equine MSCs were transferred in duplicates to 24-well plates (Sarstedt, Nümbrecht, Germany) at a density of 5,104 cells/well (25.103cells/cm2). After 24 hours, the supernatant was discarded and replaced by the medium for each experimental group: Control group (complete culture medium); Stimulated group (complete culture medium + 10 ng/ml LPS); Stimulated group + vehicle (complete culture medium + 10 ng/ml LPS + 0.05% DMSO); Stimulated group + 3 μM CBD (complete culture medium + 10 ng/ml LPS + 3 μM CBD); Stimulated group + 5 μM CBD (complete culture medium + 10 ng/ml LPS + 5 μM CBD); and Stimulated group + 7 μM CBD (complete culture medium + 10 ng/ml LPS + 7 μM CBD). Treatments were maintained for a period of 24 and 48 hours. At the end of treatment, cells were lysed using 1 ml of TRIzolTM (InvitrogenTM) and samples kept at -80°C for subsequent analysis. RNA extraction with the same reagent was performed according to the manufacturer's instructions. The RNA was eluted with RNA- free water, quantified and analyzed by spectrophotometry with the Thermo Scientific NanoDrop 2000 equipment (ThermoFisher Scientific, Wilmington, USA) for the 28 absorbance ratios 260/280 nm and 260/230 nm. cDNA synthesis was performed using the High-Capacity cDNA Reverse Transcription Kit reagents (Applied Biosystems™, Life Technologies Corporation, Carlsbad, USA), according to the manufacturer's instructions, and reverse transcription was performed to obtain cDNA with the Veriti 96 Well Thermal Cycler (Applied Biosystems™, ThermoFisher Scientific), under the following thermal cycling conditions: 10 minutes at 25ºC; 12 minutes at 37°C; and 5 minutes at 85°C. The cDNA samples were cryopreserved at -80ºC and used as templates for PCR reactions. Reactions were performed in duplicates using cDNA produced previously with PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™, Life Technologies, Carlsbad, CA, USA), RNA-free water, and equine primers (Thermo Fisher Scientific, São Paulo, Brazil ), which were designed using Primer Express™ Software v3.0.1 (Applied Biosystems™, Thermo Fischer Scientific) shown in Table 1. Samples were tested with two reference genes, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and beta-actin (ACTB). The real-time polymerase chain reaction (qPCR) method was performed with the QuantStudio™ 12K Flex Real-Time PCR System thermocycler (Applied Biosystems™, Thermo Fischer Scientific) with the following parameters: 50°C for 2 minutes, 95 °C for 2 minutes and 40 cycles of 95 °C for 1 second and 60 °C for 30 minutes with subsequent dissociation curve. The relative quantification of the expression of the genes of interest was performed using the ΔΔCt method.21 Table 1. Primers used to analyze gene expression using the qPCR technique. PRIMER FORWARD REVERSE IL-1ß GCAGCCATGGCAGCAGTA ATTGCCGCTGCAGTAAGTCA IL-6 AACAACTCACCTCATCCTTCGAA CGAACAGCTCTCAGGCTGAAC IL-10 CGGCCCAGACATCAAGGA TCGGAGGGTCTTCAGCTTTTC INF-ɣ CTGTCGCCCAAAGCTAACCT GGCCTCGAAATGGATTCTGA TNF-ɑ TTGGATGGGCTGTACCTCATC GGGCAGCCTTGGCCTTT NGF CCAACGGAGCAGCTTTCTGT AACAACATGGACATTACGCTATGC BDNF TTGGATGAGGGCCAGAAAGT CAAGTCCGCGTCCTTACTGTT GDNF CAGGGACTCTTCCTCCATCCT TGGGCACGAGCATGTTTCT GAPDH GGCAAGTTCCATGGCACAGT GGGCTTTCCGTTGATGACAA ACTB CGGCGGCTCCATTCTG CTGCTTGCTGATCCACATCTG 29 Statistical analysis The results obtained in the qPCR and cell proliferation and viability analyzes were submitted to the non-parametric Kruskal-Wallis test at each evaluation moment separately (24 and 48 h) to compare the treatments (P<0.05). When there was a statistically significant difference, the Tukey test was performed to compare the medians of the groups within the same moment (P<0.05). For each group, the Wilcoxon test (P<0.05) was performed to compare the evaluation between moments. Analyzes were performed using the Sigma Stat 3.5 program. RESULTS Cellular metabolic activity Only treatment at a dose of 9µM after 24 hours (median=79.6%) revealed to significantly affect the metabolic activity of the MSCs as shown in Figure 2, compared to the control (median=100%) and 0.05% DMSO groups (median= 98.3%). D M E M 0, 05 % D M SO 3 uM 5 uM 7 uM 9 uM D M E M 0, 05 % D M SO 3 uM 5 uM 7 uM 9 uM 50 100 150 MSC metabolic activity after 24 and 48 hours in experimental groups Treatment S u rv iv a l (% ) 24 h 48 h ✱ ✱✱ 30 Figure 2. Cell metabolic activity (%) of experimental groups treated with DMEM, 0.05% DMSO and CBD 3, 5, 7 and 9 µM after 24 and 48 hours of treatment. The group treated with CBD 9 µM showed a significant difference in relation to the control group (*) and treated with 0.05% DMSO (**) after 24 hours. P value: P<0.01. Gene expression of neurotrophic factors The expression of gene related to the neurotrophic factor BDNF showed a significant difference only between group stimulated with LPS (median=1.09) and treated with 0.05% DMSO (median=1.82) after 48 hours (Figure 3A; Appendix 2 – Table 1). Furthermore, there was also a significant increase between 24 and 48 hours when the values of the DMSO group (median=1.29; 1.82) and 3µM treatment (median=1.02; 1.45) were observed. Although there was no significant difference in relation to the control and stimulated groups, the expression of GDNF was reduced in the group treated with 7µM after 48 hours (median=0.73) when compared to the treatment with 3µM (median=1.22) and 0,05% DMSO (median= 1.33) at the same time (Figure 3B; Appendix 2 – Table 2). Regarding NGF, at both 24 and 48 hours, treatment with CBD at doses of 3µM (median=0.81; 0.74), 5µM (median=0.80; 0.79) and 7µM ( medians=0.74; 0.71) were able to significantly reduce their expression when compared to the group stimulated with LPS (medians=1.08; 0.96) (Figure 3C; Appendix 2 – Table 3). Furthermore, a significant reduction in its expression was observed between 24 and 48 hours within the 7µM group (medians= 0.74; 0.71). Gene expression of cytokines LPS was able to change only the expression of IL-1ß after 24 hours of culture, showing an increase in its expression in the stimulated group (median=1.58) when compared to control group, without stimulation (median= 0.97). At the same time, a significant reduction in its expression was observed when comparing the group stimulated with LPS with the groups treated with 3µM (median= 1.24) and 7µM (median= 0.72) (Figure 3D; Appendix 2 – Table 4). 31 The expression of IL-6 showed a significant difference between the groups in both moments (Figure 3E; Appendix 2 – Table 5). After 24 hours, there was a reduction in its expression when comparing the group stimulated with LPS (median= 1.31) with the treatments of 5µM (median= 0.42) and 7µM (median= 0.23), while after 48 hours, this difference between the group stimulated with LPS (median=1.8) was significant in relation to treatment with 3µM (median=0.4), 5µM (median=0.28) and 7µM (median=0.16). Furthermore, the three treated groups showed a reduction in their expression between 24 and 48 hours, being 3µM (median=0.63;0.4), 5µM (median=0.42;0.28) and 7µM (median=0.23;0.16). No significant differences were observed between groups and time points regarding cytokine IL-10 and (Figure 3F; Appendix 2 – Table 6). A significant difference was observed in the expression of TNF-ɑ only when we compared the 0,05% DMSO group between the 24 hours (median= 0.78) and 48 hours (median= 1.51) (Figure 3G; Appendix 2 – Table 7). Although there was no significant difference between the groups, stimulation with LPS showed a tendency to promote a significant increase in IFN-ɣ expression between the 24-hour (median=0.73) and 48-hour (median=1.38) (Figure 3H; Appendix 2 – Table 8). 32 D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0 1 2 3 4 BDNF Treatment R el a ti v e ex p re ss io n 24 h 48 h ✱✱✱ ✱✱✱ ✱ A D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0 2 4 6 8 GDNF Treatment R el a ti v e ex p re ss io n 24 h 48 h ✱✱ ✱✱ B D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0 1 2 3 IL-1b Treatment R el a ti v e ex p re ss io n 24 h 48 h ✱✱ ✱✱ ✱✱ ✱✱✱ D D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0 2 4 6 8 10 IL-6 Treatment R el a ti v e ex p re ss io n 24 h 48 h ✱ ✱ ✱ ✱ ✱ ✱ ✱✱✱ ✱✱✱ E D M E M L P S L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L P S L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0 1 2 3 4 5 IL-10 Treatment R e la ti v e e x p r e ss io n 24 h 48 h F D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0.0 0.5 1.0 1.5 2.0 2.5 NGF Treatment R el a ti v e ex p re ss io n 24 h 48 h ✱ ✱ ✱ ✱ ✱ ✱ ✱✱✱ C D M E M L P S L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L P S L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0 1 2 3 4 5 TNF-a Treatment R e la ti v e e x p r e ss io n 24 h 48 h ✱ G D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M D M E M L PS L PS + 0 ,0 5% D M SO L PS + C B D 3 µ M L PS + C B D 5 µ M L PS + C B D 7 µ M 0 1 2 3 4 IFN-ɣ Treatment R e la ti v e e x p r e ss io n 24 h 48 h ✱✱ H 33 Figure 3. . Relative expression of BDNF (A), GDNF (B), NGF (C), IL-1ß (D), IL-6 (E), IL-10 (F), TNF-ɑ (G) and IFN-ɣ (H) between experimental groups at 24 and 48 hours. Data were represented as median, and 25th and 75th percentiles. P values: P<0.001*, P<0.01**, P<0.05***. DISCUSSION In this work, the influence of cannabidiol on gene expression of factors related to the inflammatory and neurotrophic response of equine MSCs in vitro was evaluated. In this species, the anti-inflammatory capacity of CBD has already been demonstrated in culture of peripheral blood mononuclear cells in vitro, promoting reduction of the genic expression and cytokine secretion of IFN-ɣ and TNF-ɑ by circulating lymphocytes.22 However, the effects of cannabidiol on equine MSCs are still unknown. In this study was evidenced that stimulation with CBD with a dose up to 7 µM did not impair the metabolic activity of equine MSCs, as well as was able to reduce the gene expression of the inflammatory cytokines IL-6 and IL-1b in an inflammatory environment, while showing no interference in the direct secretion of neurotrophic factors by equine MSCs. Low doses of LPS is considered ideal to mimic the stimuli suffered by human MSCs in the face of inflammatory and infectious processes in vivo.23,24 Although the low concentration of LPS is capable to promote activation of human MSCs, inducing a pro- inflammatory phenotype and increase the expression of pro-inflammatory genes, a dose- dependent effect was also described, in which doses up to 1µg/ml promoted a progressive increasing in the secretion of inflammatory cytokines as IL-6 and IL-1ß.25 With the exception of IL-1ß, which was shown to be responsive to the dose of LPS used after 24 hours of stimulation and perhaps more sensible, the absence of change in the values referring to the other immunomodulatory factors may be related to the need for a more intense inflammatory stimulus or a difference in the conformation of TLR-4 receptor between species, since previous studies described this variations in humans, rats, mice and chimpanzees, and which influences their ability and intensity of response to their agonists.5,26 In human MSCs, CBD was able to reduce the gene expression of several genes related to cytokines and pro-inflammatory pathways, such as IL-1ß, TLR, IFN-ɣ receptors, NF-κB- 34 dependent pathway, transcription factors (STAT) and mitogen-activated protein kinase (MAPK).17 Thus, the ability of CBD to inhibit one of the main pathways used by TLR-4, the NF-κB and STAT-dependent pathway, could partially explain its anti-inflammatory activity against stimulation with LPS.17,27 Still, observing the response of equine MSCs to the different doses of cannabidiol-rich extract used, we noticed a tendency of reduced cellular metabolic activity with the increasing of CBD concentration, although this reduction only becomes significant when close to the value of 9 µM. This finding corroborates that observed by other authors, who describe the toxicity of cannabidiol when cultured with human MSCs close to 10 µM.28–30 Reduction in the expression of the gene related to NGF observed in the experimental groups at both moments are in agreement with other studies performed in vivo and in vitro.19,31 The neurotrophic activity of CBD was attributed to its interaction with tropomyosin kinase receptors A (TrkA), the main target of NGF, and the mechanism which canabidiol reduces the level of expression of NGF may be related to triggered responses evoked by its interaction with TrkA.19 Difference in the expressed levels of BDNF was observed only between group treated with 0,05% DMSO and LPS stimulated after 48 hours. The expression of the tropomyosin kinase B receptor (TrkB) has already been observed in MSCs, and its stimulation has proven to play an important role in the production of BDNF by these cells.32 Sales et al. showed the ability of CBD to bind to TrkB and promote BDNF protein expression in vivo, however this elevated expression was only seen 30 minutes after CBD administration, returning to normal values over time.32,33 Therefore, this finding corroborate with other studies, where analysis on days 5 to 10 after treatment with canabidiol in vivo presented no difference in the expression or secretion of this neurotrophin.31,34 This can be explained by the fact that in the later moments of tissue damage, it is followed by the activation of pathways related to anti-inflammatory activity and completion of repair at the injured site, presenting a reduced secretion of inflammatory cytokines and neurotrophic factors.31,33,34 No difference in GDNF expression was observed between LPS stimulated group and any experimental group at both time points. Similarly to seen by other authors, canabidiol does not seems to influence the level of GDNF in vivo and in vitro.19,31,34 Since none of the 35 cytokines, BDNF, GDNF and NGF, showed no tendency to increase their expression, one of the possibilities may be the fact that the neurotrophic potential of CBD is based on its immunomodulatory, anti-apoptotic and antioxidant capacity and its influence on other cell types, such as Schwann cells, rather than its direct stimulation in the production of these neurotrophins.34 Therefore, studies that analyze the influence of CBD and MSCs when inserted in an inflammatory environment, and their interaction with other cell types, are important for a better understanding of their exact mechanism of action. There was no change in IL-10 expression between the analyzed groups. Nemeth et al. studied the influence of bone marrow mesenchymal stem cells treatment in a murine model of sepsis, and infusion of MSCs from IL-10-/- animals was still able to promote the increase of IL-10, suggesting that other cells such as macrophages, monocytes and lymphocytes produce this factor.35 Production of IL-10 occurs largely by recruited macrophages, reaching the peak of recruitment around seven days post-injury.13,36 The moments of analysis, with 24 and 48 hours, may be responsible for the low genic expression of IL-10 in the equine MSCs, as well as the supposed low production of IL-10 by MSCs, previously reported.35 IL-6 is a pro-inflammatory cytokine related with acute injuries, participating in the recruitment of immune cells and elimination of local antigens when associated with the soluble complex IL-6R (sIL-6R), a membrane receptor and soluble factor found in neutrophils.37,38 The interaction of IL-6 with sIL-6R may function as a stimulus to leukocyte infiltration, extended neutrophil half-life and tissue damage.39 The ability of CBD to inhibit NF-κB-dependent and STAT3-related signaling pathways, some of the most important for the synthesis of pro-inflammatory cytokines, may be responsible by the decrease in the expression of IL-6 observed in the experimental groups. Therefore, reduction in the expression of IL-6 may be benefic in the initial phase of peripheral nerve injuries, preventing excessive tissue damage that may be followed by neutrophil infiltration and activation. Gene expression of IL-1ß was significantly increased in LPS stimulated group when compared with control group and experimental groups treated with CBD 3 and 7 µM after 24 hours. During the beginning of the inflammatory process, macrophages, immune cells 36 and eventually resident MSCs are recruited to the site of lesion and the secretion of pro- inflammatory molecules by local cells is initiated, reaching the peak of production approximately 24 hours after the injury.13,23,24 This can explain the increasing seen in the expression level of IL-1ß after 24 hours in stimulated group, since MSCs can play an important role in the immunomodulatory and chemotactic activity at the site of injury. Still, after the period of 24 and 48 hours characterized by cellular recruitment, MSCs at the lesion site begin to activate pathways related to tissue repair and reduce pathways related to pro-inflammatory and migratory activity.24 The reduction in IL-1ß expression in groups 3 and 7µM at the 24-hour period can possibly be explained by the activity of CBD on the NF- κB-dependent pathway, which would inhibit the production of pro-inflammatory cytokines by MSCs, corroborating with Libro et al.40,17 Both cytokines, IL-1ß e IL-6, play an important role in the first hours after peripheral nerve injury, participating mainly in the recruitment of defense cells to the injury site.9 One of the goals of cell therapy is to promote local immunomodulation and neuroregeneration. However, when inserted in an inflammatory environment, the ability of MSCs to acquire a pro-inflammatory phenotype has already been proven, which can often cause unwanted effects.23,24 Therefore, the ability of CBD to promote a reduction of gene expression of both cytokines, which have a pro-inflammatory function in the first hours after injury, may be a beneficial factor when referring to the transplantation of local MSCs aiming to reduce an excessive and harmful initial inflammatory response. The increase in TNF-ɑ expression in the 0,05% DMSO group when compared at 24 and 48 hours can be explained by the synergy observed between this cytokine and DMSO, which activate the DMSO pathway signaling related to MAPK, one responsible for stimulating the expression of pro-inflammatory genes.41,42 Furthermore, the increased expression of IFN-ɣ in the LPS stimulated group between 24 and 48 hours may be possibly explained by the synergy of both components, IFN-ɣ and LPS, on NF-κB and STAT1- dependent signaling pathways.42,43 CONCLUSION 37 Cannabidiol showed a reduction in gene expression related to pro-inflammatory cytokines IL-6 e IL-1ß, and although it was unable to influence gene expression of cytokines IL-10, IFN-ɣ and TNF-ɑ, may be an important indicator of its immunomodulatory capacity. CBD was not able to upregulate the gene expression of NGF, BDNF e GDNF, however its known efficacy on the treatment of central nervous system diseases makes studies about its interaction with MSCs and other cells types necessary for a better understanding of its mechanism of action. Still, taking into account the particularities and sensitivity of each species to different stimuli, studies on possible protocols to be used as an inflammatory model for the equine species should be carried out. Acknowledgments The authors are grateful for the financial support of Coordination for the Improvement of Higher Education Personnel - Brazil (CAPES), and to NeoGene Laboratory (FMB, Unesp, Botucatu) for the assistance in perfoming the qPCR procedures. Authors’ Contributions All authors approved the final version of this article. Conflict of Interest None declared. Funding statement None declared. Supplementary Material Supplementary Appendix S1 Supplementary Appendix S2 38 References 1. Simon NG, Spinner RJ, Kline DG, et al. Advances in the Neurological and Neurosurgical Management of Peripheral Nerve Trauma. J Neurol Neurosurg Psychiatry 2016;87(2):198–208; doi: 10.1136/jnnp-2014-310175. 2. Udina E, Cobianchi S, Allodi I, et al. Effects of Activity-Dependent Strategies on Regeneration and Plasticity after Peripheral Nerve Injuries. Ann Anat 2011;193(4):347–353; doi: 10.1016/j.aanat.2011.02.012. 3. Boorman S, Scherrer NM, Stefanovski D, et al. Facial Nerve Paralysis in 64 Equids: Clinical Variables, Diagnosis, and Outcome. J Vet Intern Med 2020;34(3):1308– 1320; doi: 10.1111/jvim.15767. 4. Sanchez DNR, Bertanha M, Fernandes TD, et al. Effects of Canine and Murine Mesenchymal Stromal Cell Transplantation on Peripheral Nerve Regeneration. Int J Stem Cells 2017;10(1):83–92; doi: 10.15283/ijsc16037. 5. Vézina Audette R, Lavoie-Lamoureux A, Lavoie JP, et al. Inflammatory Stimuli Differentially Modulate the Transcription of Paracrine Signaling Molecules of Equine Bone Marrow Multipotent Mesenchymal Stromal Cells. Osteoarthr Cartil 2013;21(8):1116–1124; doi: 10.1016/j.joca.2013.05.004. 6. Tomita K, Madura T, Sakai Y, et al. Glial Differentiation of Human Adipose- Derived Stem Cells: Implications for Cell-Based Transplantation Therapy. Neuroscience 2013;236:55–65; doi: 10.1016/j.neuroscience.2012.12.066. 7. Cortés-Araya Y, Amilon K, Rink BE, et al. Comparison of Antibacterial and Immunological Properties of Mesenchymal Stem/Stromal Cells from Equine Bone Marrow, Endometrium, and Adipose Tissue. Stem Cells Dev 2018;27(21):1518– 1525; doi: 10.1089/scd.2017.0241. 8. Caillaud M, Richard L, Vallat JM, et al. Peripheral Nerve Regeneration and Intraneural Revascularization. Neural Regen Res 2019;14(1):24–33; doi: 10.4103/1673-5374.243699. 9. Li X, Guan Y, Li C, et al. Immunomodulatory Effects of Mesenchymal Stem Cells in Peripheral Nerve Injury. Stem Cell Res Ther 2022;13(1):1–13; doi: 39 10.1186/s13287-021-02690-2. 10. Marchalant Y, Cerbai F, Brothers HM, et al. Cannabinoid Receptor Stimulation Is Anti-Inflammatory and Improves Memory in Old Rats. Neurobiol Aging 2008;29(12):1894–1901; doi: 10.1016/j.neurobiolaging.2007.04.028. 11. Rodrigues RS, Lourenço DM, Paulo SL, et al. Cannabinoid Actions on Neural Stem Cells: Implications for Pathophysiology. 2019.; doi: 10.3390/molecules24071350. 12. Wong H and Cairns BE. Cannabidiol, Cannabinol and Their Combinations Act as Peripheral Analgesics in a Rat Model of Myofascial Pain. Arch Oral Biol 2019;104(May):33–39; doi: 10.1016/j.archoralbio.2019.05.028. 13. Rotshenker S. Wallerian Degeneration: The Innate-Immune Response to Traumatic Nerve Injury. J Neuroinflammation 2011;8(August); doi: 10.1186/1742-2094-8-109. 14. Aamar S, Saada A and Rotshenker S. Lesion‐Induced Changes in the Production of Newly Synthesized and Secreted Apo‐E and Other Molecules Are Independent of the Concomitant Recruitment of Blood‐Borne Macrophages into Injured Peripheral Nerves. J Neurochem 1992;59(4):1287–1292; doi: 10.1111/j.1471- 4159.1992.tb08439.x. 15. Saada A, Dunaevsky‐Hutt A, Aamar A, et al. Fibroblasts That Reside in Mouse and Frog Injured Peripheral Nerves Produce Apolipoproteins. J Neurochem 1995;64(5):1996–2003; doi: 10.1046/j.1471-4159.1995.64051996.x. 16. Pandey S and Mudgal J. A Review on the Role of Endogenous Neurotrophins and Schwann Cells in Axonal Regeneration. J Neuroimmune Pharmacol 2021;(0123456789); doi: 10.1007/s11481-021-10034-3. 17. Libro R, Scionti D, Diomede F, et al. Cannabidiol Modulates the Immunophenotype and Inhibits the Activation of the Inflammasome in Human Gingival Mesenchymal Stem Cells. Front Physiol 2016;7(November):1–17; doi: 10.3389/fphys.2016.00559. 18. Moreno-Martet M, Espejo-Porras F, Fernández-Ruiz J, et al. Changes in Endocannabinoid Receptors and Enzymes in the Spinal Cord of Sod1g93a Transgenic Mice and Evaluation of a Sativex®-like Combination of Phytocannabinoids: Interest for Future Therapies in Amyotrophic Lateral Sclerosis. CNS Neurosci Ther 2014;20(9):809–815; doi: 10.1111/cns.12262. 40 19. Santos NAG, Martins NM, Sisti FM, et al. The Neuroprotection of Cannabidiol against MPP+-Induced Toxicity in PC12 Cells Involves TrkA Receptors, Upregulation of Axonal and Synaptic Proteins, Neuritogenesis, and Might Be Relevant to Parkinson’s Disease. Toxicol Vitr 2015;30(1):231–240; doi: 10.1016/j.tiv.2015.11.004. 20. Barberini DJ, Freitas NPP, Magnoni MS, et al. Equine Mesenchymal Stem Cells from Bone Marrow, Adipose Tissue and Umbilical Cord: Immunophenotypic Characterization and Differentiation Potential. Stem Cell Res Ther 2014;5(1):1–11; doi: 10.1186/scrt414. 21. Livak KJ and Schmittgen TD. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCT Method. Methods 2001;25(4):402– 408; doi: 10.1006/meth.2001.1262. 22. Turner S, Barker VD and Adams AA. Effects of Cannabidiol on the In Vitro Lymphocyte Pro-Inflammatory Cytokine Production of Senior Horses. J Equine Vet Sci 2021;103; doi: 10.1016/j.jevs.2021.103668. 23. Betancourt AM. New Cell-Based Therapy Paradigm: Induction of Bone Marrow- Derived Multipotent Mesenchymal Stromal Cells into Pro-Inflammatory MSC1 and Anti-Inflammatory MSC2 Phenotypes. 2012;163–197; doi: 10.1007/10_2012_141. 24. Waterman RS, Tomchuck SL, Henkle SL, et al. A New Mesenchymal Stem Cell (MSC) Paradigm: Polarization into a pro-Inflammatory MSC1 or an Immunosuppressive MSC2 Phenotype. PLoS One 2010;5(4); doi: 10.1371/journal.pone.0010088. 25. Romieu-Mourez R, François M, Boivin M-N, et al. Cytokine Modulation of TLR Expression and Activation in Mesenchymal Stromal Cells Leads to a Proinflammatory Phenotype. J Immunol 2009;182(12):7963–7973; doi: 10.4049/jimmunol.0803864. 26. Smirnova I, Poltorak A, Chan EK, et al. Phylogenetic Variation and Polymorphism at the Toll-like Receptor 4 Locus (TLR4). Genome Biol 2000;1(1):1–10; doi: 10.1186/gb-2000-1-1-research002. 27. Clark AK, Old EA and Malcangio M. Neuropathic Pain and Cytokines: Current 41 Perspectives. J Pain Res 2013;6:803–814; doi: 10.2147/JPR.S53660. 28. Miller H, De Leo N, Badach J, et al. Role of Marijuana Components on the Regenerative Ability of Stem Cells. Cell Biochem Funct 2021;39(3):432–441; doi: 10.1002/cbf.3609. 29. Soundara Rajan T, Giacoppo S, Scionti D, et al. Cannabidiol Activates Neuronal Precursor Genes in Human Gingival Mesenchymal Stromal Cells. J Cell Biochem 2017;118(6):1531–1546; doi: 10.1002/jcb.25815. 30. Sun Y and Dolmetsch RE. Investigating the Therapeutic Mechanism of Cannabidiol in a Human Induced Pluripotent Stem Cell (IPSC)-Based Model of Dravet Syndrome. Cold Spring Harb Symp Quant Biol 2018;83:185–191; doi: 10.1101/sqb.2018.83.038174. 31. Perez M, Politti L, Bortolança G, et al. Short and Long-Term Neuroprotective Effects of Cannabidiol after Neonatal Peripheral Nerve Axotomy. 2021;197(February); doi: 10.1016/j.neuropharm.2021.108726. 32. Heo H, Yoo M, Han D, et al. Upregulation of TrkB by Forskolin Facilitated Survival of MSC and Functional Recovery of Memory Deficient Model Rats. Biochem Biophys Res Commun 2013;431(4):796–801; doi: 10.1016/j.bbrc.2012.12.122. 33. Sales AJ, Fogaça M V., Sartim AG, et al. Cannabidiol Induces Rapid and Sustained Antidepressant-Like Effects Through Increased BDNF Signaling and Synaptogenesis in the Prefrontal Cortex. Mol Neurobiol 2019;56(2):1070–1081; doi: 10.1007/s12035-018-1143-4. 34. Ceprián M, Vargas C, García-toscano L, et al. Cannabidiol Administration Prevents Hypoxia-Ischemia-Induced Hypomyelination in Newborn Rats. 2019;10(September):1–10; doi: 10.3389/fphar.2019.01131. 35. Németh K, Leelahavanichkul A, Yuen PST, et al. Bone Marrow Stromal Cells Attenuate Sepsis via Prostaglandin E 2-Dependent Reprogramming of Host Macrophages to Increase Their Interleukin-10 Production. Nat Med 2009;15(1):42– 49; doi: 10.1038/nm.1905. 36. Mietto BS, Kroner A, Girolami EI, et al. Role of IL-10 in Resolution of Inflammation and Functional Recovery after Peripheral Nerve Injury. J Neurosci 42 2015;35(50):16431–16442; doi: 10.1523/JNEUROSCI.2119-15.2015. 37. Scheller J, Chalaris A, Schmidt-Arras D, et al. The Pro- and Anti-Inflammatory Properties of the Cytokine Interleukin-6. Biochim Biophys Acta - Mol Cell Res 2011;1813(5):878–888; doi: 10.1016/j.bbamcr.2011.01.034. 38. Jones SA, Scheller J and Rose-John S. Therapeutic Strategies for the Clinical Blockade of IL-6/Gp130 Signaling. J Clin Invest 2011;121(9):3375–3383; doi: 10.1172/JCI57158. 39. Chalaris A, Rabe B, Paliga K, et al. Apoptosis Is a Natural Stimulus of IL6R Shedding and Contributes to the Proinflammatory Trans-Signaling Function of Neutrophils. Blood 2007;110(6):1748–1755; doi: 10.1182/blood-2007-01-067918. 40. Libro R, Diomede F, Scionti D, et al. Cannabidiol Modulates the Expression of Alzheimer’s Disease-Related Genes in Mesenchymal Stem Cells. Int J Mol Sci 2017;18(1):1–19; doi: 10.3390/ijms18010026. 41. Yu HN, Lee YR, Noh EM, et al. Tumor Necrosis Factor-α Enhances DMSO-Induced Differentiation of HL-60 Cells through the Activation of ERK/MAPK Pathway. Int J Hematol 2008;87(2):189–194; doi: 10.1007/s12185-008-0037-z. 42. Peyravian N, Deo S, Daunert S, et al.

Cannabidiol as a Novel Therapeutic for Immune Modulation

. ImmunoTargets Ther 2020;Volume 9:131–140; doi: 10.2147/itt.s263690. 43. Piaszyk-Borychowska A, Széles L, Csermely A, et al. Signal Integration of IFN-I and IFN-II with TLR4 Involves Sequential Recruitment of STAT1-Complexes and NFκB to Enhance pro-Inflammatory Transcription. Front Immunol 2019;10(JUN):1– 20; doi: 10.3389/fimmu.2019.01253. 43 Appendix 1 Analysis of the extract rich in cannabidiol through the method of high performance liquid chromatography (HPLC) by the company DALL Soluções Analíticos e Empresariais. 44 Appendix 2. Tables referring to the relative gene expression of cytokines and neurotrophic factors 45 46 2966352cc43e47458221c43ad1e8cbac65819dfaa2f269862f9236116c4fb913.pdf 2966352cc43e47458221c43ad1e8cbac65819dfaa2f269862f9236116c4fb913.pdf 2966352cc43e47458221c43ad1e8cbac65819dfaa2f269862f9236116c4fb913.pdf RESUMO ABSTRACT Capítulo 1 1.1 INTRODUÇÃO 1.2 REVISÃO DE LITERATURA 1.2.1 Sistema nervoso periférico 1.2.1.1 Classificação das lesões nervosas periféricas 1.2.1.2 Lesões ao sistema nervoso periférico 1.2.2 Cannabis sativa 1.2.3 Sistema endocanabinóide 1.2.4 Canabidiol 1.2.5 Células Tronco Mesenquimais 1.2.5.1 Ativação das Células Tronco Mesenquimais 1.2.5.2 Participação das Células Tronco Mesenquimais na regeneração nervosa 1.3 HIPÓTESE 1.4 OBJETIVOS 1.4.1 Objetivo geral 1.4.2 Objetivos específicos 1.5 Referências Capítulo 2 1.6 Trabalho científico