�

UNIVERSIDADE ESTADUAL PAULISTA “JULIO DE MESQUITA FILHO” 

FACULDADE DE MEDICINA 

CAMPUS DE BOTUCATU 

 
 
 
 
 

REMODELAMENTO PARENQUIMATOSO PULMONAR EM 

DOIS MODELOS EXPERIMENTAIS DE FIBROSE 

 

 

Doutorando: Alexandre Todorovic Fabro 

Orientadora: Prof Dra Vera Luiza Capelozzi 

Co-orientadora: Prof Dra Claudia Aparecida Rainho 

Tese apresentada ao Programa de Pós-

Graduação em Patologia da Faculdade 

de Medicina de Botucatu, Universidade 

Estadual Paulista – UNESP para 

obtenção do título de Doutor em 

Patologia. 

BOTUCATU – SP 

2012 



�

 

 

 

 

 

 

 

 

 

 

 
 

Fabro, Alexandre Todorovic. 
     Remodelamento parenquimatoso pulmonar em dois modelos experimentais de 
fibrose / Alexandre Todorovic Fabro. -   Botucatu, 2012 
   
    Tese (doutorado) -  Faculdade de Medicina de Botucatu, Universidade Estadual 
Paulista, 2012 
    Orientador: Vera Luiza Capelozzi 
    Co-orientador: Claudia Aparecida Rainho 
    Capes: 40105008 
      

1. Fibrose Pulmonar - Matrix extracelular - IL-17 – Estudos experimentais.       
                                               
 
 
                    
Palavras-chave: Fibrose Pulmonar; Colágenos; IL-17; Modelos Experimentais; IL-17 
Knockout mice; Citocinas 

 

 

 



�

Dedicatória



�

Aos meus pais, Nicosava e Jair (in�memoriam), pelo nosso lar, 

o berço do meu destino. 

Aos meus irmãos, Ana Rosa e Adriano, pela sublime paciência 

 e caridade do convívio diário.

A minha esposa, Patrícia, pelo templo aberto ao coração 

com amor, ternura e  dedicação. 



�

Agradecimentos



�

À minha orientadora Prof Dra Vera Luiza Capelozzi pelo empolgante e 

incessante entusiasmo científico. 

À minha co-orientadora Prof Dra Claudia Aparecida Rainho por apoiar novas 

idéias e abrir seu laboratório. 

Ao Prof Dr Helmut Popper, pelo estágio sanduíche e construtivas discussões 

científicas. 

À Prof Dra Walcy Rosolia Teodoro e a Ana Paula Pereira Velosa, pela 

belíssima dedicação nas pesquisas dos colágenos. 

Ao Prof Dr Edwin Roger Parra-Cuentas, pelo esforço no desenvolvimento da 

pesquisa em pulmão.  

À Prof Dra Márcia Guimarães Silva, pelo incentivo e apoio na Programa de Pós 

Graduação de Patologia.  

Ao Igor Ótavio Minatel, pela ajuda e participação incondicional ao projeto na 

parte experimental na FM-UNESP. 

Ao Paulo César Georgete, pelo sua alegria em colaborar e tratar dos animais 

no Biotério da Patologia – FM-UNESP. 

À Erika da Costa Prado, pelo seu profissionalismo e desempenho no 

Laboratório de Genética - IBB. 

À Mariana Bizzaro dos Reis, pela apoio e disposição para os experimentos no 

Laboratório de Genetica - IBB. 

À Sandra de Morais Fernezlian, pelo perfeito trabalho na imunoistoquímica na 

FMUSP. 

À todos os Professores e Funcionários do Departamento de Patologia do 

HCFMB, pela importante contribuição desde minha graduação. 



�

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

Epígrafe 
 
 
 
 



�

 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 
 

“Somente hoje 
Hoje a luz do presente  

Dia como este dia 
Em toda a vida 

Terás este somente 
Recorda isso 

E atende todo o bem que desejes fazer 
Prestação de serviço em socorro de alguém... 

...Contando sempre aquilo que se fez 
E dia igual a hoje, só terás uma vez”

Francisco�de�Paula�Cândido�Xavier



�

Sumário



�

1. Revisão da literatura....................................................................................11

2. Referências bibliográficas.................................... .................................... 30 

3. Hipótese de Trabalho.............................................. ...................................51

4. Objetivos...................................................................................................... 53 

5. Resumo........................................................................................................ 55 

6. Abstract....................................................................................................... 57 

7. Artigo científico........................................................................................... 59 

8. Conclusões.................................................................................................. 95 

9. Anexos......................................................................................................... 97 



� 11

1. REVISÃO DA LITERATURA 



� 12

A fibrose pulmonar é caracterizada pela deposição de matriz extracelular 

nos interstícios pulmonares como o axial, septal e/ou periférico em resposta 

crônica reparativa a um processo injuriante. A unidade alvéolo-capilar pode 

desta forma ser alterada e levar a perda da função pulmonar com eventual 

progressão para doença clinicamente detectável, definidas coletivamente de 

doenças pulmonares fibrosantes. Quando essa deposição de matriz 

extracelular é anormal, ou seja, não controlada, difusa e progressiva, forma-se 

um sub-grupo de doenças, as chamadas doenças pulmonares intersticiais 

difusas (Difuse Interstitial Lung Disease, DILD), termo comum a um extenso 

grupo de doenças pulmonares crônicas. Entretanto, a etiologia é determinada 

em aproximadamente um terço destas doenças intersticiais difusas, sendo que 

o restante são de causa desconhecida, levando ao diagnóstico de doenças 

idiopáticas (1-3). Isso impede uma abordagem terapêutica eficaz e resolutiva 

em algumas destas doenças com alta morbi-mortalidade, como por exemplo na 

Fibrose Pulmonar Idiopática. Os processos fibro-reparativos pulmonares de 

etiologia conhecida perfazem determinadas vias fisiopatológicas, percorrendo o 

elo entre etiologia e fibrose, como na tuberculose ou silicose. De modo 

análogo, é possível que as doenças pulmonares intersticiais difusas idiopáticas 

também sejam desencadeadas pela participação de pelo menos um estímulo 

etiológico injuriante em indivíduos susceptíveis. Após a lesão inicial, a cascata 

de eventos fisiopatológicos deve envolver controles epiteliais, imunológicos, 

genéticos, virais, vasculares e fibroblásticos (2, 4). Porém, estes estímulos 

injuriantes e suas vias fibrogênicas ainda estão a serem determinados. E 

apesar de apresentarem características semelhantes, as várias doenças 

pulmonares fibrosantes têm aspectos individuais, fazendo com que cada uma 



� 13

delas seja estudada separadamente. A gravidade das doenças envolvidas e a 

evolução clínica comumente insatisfatória da maioria delas têm motivado 

pesquisas quanto à patogênese da fibrose pulmonar de muitos centros de 

pesquisas. 

As alterações estruturais dessas patologias consistem no acometimento 

fibro-inflamatório das pequenas vias aéreas caracterizadas pelo espessamento 

do interstício septal, por deposição acentuada de matriz extracelular, infiltrado 

inflamatório, remodelamento bronquiolar com alteração das células epiteliais e 

endoteliais, dos septos alveolares e da rede vascular pulmonar (5, 6). Estudos 

histológicos, ultra-estruturais, funcionais e do lavado broncoalveolar são 

realizados em modelos experimentais na busca de semelhanças com as 

encontradas nos pacientes, com o intuito de compreender melhor os 

mecanismos evolutivos e etiopatogênicos destas doenças. Se por um lado, 

esses modelos tem permitido conhecer melhor o comportamento de tais 

doenças, por outro, tem levantado novas questões a serem investigadas. 

Modelos Experimentais 

 Com o intuito de melhor compreender os mecanismos das doenças 

pulmonares fibrosantes, a utilização de modelos experimentais permite obter 

informações significativas quanto às alterações morfológicas, funcionais e 

bioquímicas. A reprodutividade e a possibilidade do estudo controlado tem 

resultado em uma maior compreensão da patogenia do processo (7, 8). 



� 14

Fibrose Pulmonar induzida por Bleomicina (BLM).

  É um modelo experimental clássico para estudo de mecanismos 

fisiopatológicos de fibrose pulmonar.  Trata-se de um agente antimicrobiano 

com propriedades quimioterápicas, isolado de culturas de uma cepa de 

Streptomyces verticullus (9). É utilizado no tratamento inicial de linfomas, 

tumores testiculares e carcinoma de células escamosas. Dependendo da dose, 

ao longo do tempo, seu uso pode produzir inflamação e fibrose pulmonar com 

consequente redução da capacidade e volume pulmonar (10). Os primeiros 

trabalhos descrevendo a bleomicina, sua farmacologia e seus efeitos foram 

realizados em ratos (9, 11). Atualmente os roedores são os espécimes de 

eleição para os estudos de fibrose pulmonar, devido à facilidade de formação 

de colônias, manuseio e sensibilidade pulmonar (12). Os efeitos terapêuticos e 

citotóxicos da bleomicina são resultados de sua capacidade de fragmentar o 

DNA das células alvo, com conseqüente redução na síntese de RNA e 

proteínas. É possível que os danos pulmonares causados pela bleomicina 

estejam diretamente relacionados à formação de radicais livres de oxigênio por 

um mecanismo dependente de ferro (13). Além disso, a produção de radicais 

livres pode aumentar a lesão pulmonar por inativação de antiproteinases, 

rompimento de membranas e exposição da barreira alvéolo-capilar (14). Estes 

radicais agem como iniciadores, mantenedores e amplificadores da reação 

inflamatória (15). A quebra da fita de DNA seria, portanto, definida por três 

mecanismos associados e sinérgicos: a ligação simultânea da BLM com o DNA 

e o Fe+2; a fácil oxidação do Fe+2 pelo oxigênio molecular; e a geração de 

radicais livres em íntima proximidade com o DNA (16, 17). O uso da BLM 

também é relacionado com o aumento seletivo de RNAs mensageiros 



� 15

específicos que codificam a produção de proteínas como o procolágeno-alfa 1, 

a elastina e a fibronectina dos pulmões, que tem papel determinante na gênese 

da fibrose, e mediadores inflamatórios que acarretam em uma migração e 

ativação de neutrófilos e linfócitos semelhante ao estímulo infeccioso (18-22). A 

migração de polimorfonucleares ativados para o tecido pulmonar e a liberação 

de proteases lisossômicas destrói o colágeno e outras proteínas estruturais, 

estimulam a migração de linfócitos e ativação dos fibroblastos. A conseqüência 

histológica desta destruição é o espessamento septal por edema e por 

infiltração de células inflamatórias e deposição de colágeno. A lesão é 

heterogênea e a região axial e periférica é a mais intensamente comprometida 

com presença de mononucleares e neoformação intensa de colágeno. Nas 

regiões periféricas, as lesões são observadas ao longo da região subpleural 

posterior (23). A destruição alveolar pode ser observada pela presença de 

alterações das células alveolares e presença de material proteináceo nos 

espaços alveolares, até pelo total desarranjo estrutural com conseqüente 

substituição por tecido fibrótico. 

Fibrose Pulmonar induzida por Paraquat (PQ).

 Outro modelo experimental para estudo dos mecanismos de fibrose 

pulmonar é obtido com o paraquat. Os efeitos tóxicos do herbicida paraquat 

podem ser entendidos, em grande parte, por uma reação de oxido-redução, 

que compreende a transferência de um elétron para o NADP, com formação de 

NADPH celular e formas oxidadas potencialmente tóxicas, como o radical 

superóxido. O citocromo P450 redutase microsomal, atua como catalisador 



� 16

dessa reação (24). O paraquat acumula-se ativamente nos pneumócitos tipo I e 

II, através de um mecanismo dependente de energia e mediado pelos canais 

seletivos de poliaminas. No interior dos pneumócitos tipo I ocorre a oxi-redução 

e auto-oxidação, mediadas pelo citocromo P450. O paraquat é reduzido por 

intermédio do NADPH e reage fortemente com o oxigênio para formar um 

radical livre de oxigênio (O2-) (24). A interação entre o anion superóxido e o 

H2O2 induz a Reação de Haber-Weiss, tendo a formação de dois radicais 

hidroxil (OH- e OH+) e oxigênio, sendo a reação catalisada pela presença do íon 

ferro (Fe2+) (25). Os radicais livres de oxigênio lesam diretamente as células, 

das paredes alveolares ativando o sistema mononuclear fagocitário, com 

eventual fibrose generalizada do tecido pulmonar. Em resumo, o mecanismo 

primário da toxicidade do paraquat baseia-se no ciclo de oxidações e reduções 

que o composto é susceptível de sofrer, e com a depleção da enzima 

superóxido dismutase, capaz de converter o íon superóxido em oxigênio. Esse 

mecanismo, sendo seletivo para as células epiteliais, causa a injúria inicial nos 

pneumócitos, precipitando edema intra-alveolar, vasodilatação e infiltrado 

inflamatório mononuclear e polimorfonuclear (26). Após três semanas observa-

se a a proliferação fibroblástica com deposição de matriz extracelular no 

interstício pulmonar (26). Consistente com esses achados, tem sido 

demonstrado o aumento do nível de expressão do RNA mensageiro do 

colágeno tipo I e da hidroxiprolina (27, 28). 



� 17

Resposta Fibrótica das Cepas Murinas dos modelos experimentais. 

 Diferentes cepas murinas apresentam respostas diversas na 

susceptibilidade ao desenvolvimento de fibrose pulmonar por drogas indutoras 

como a bleomicina (8). Desta forma, a cepa C57/B6J é mais susceptível a 

fibrose pulmonar do que a cepa Balb/c (29). Especificamente, nas fases 

intermediárias (14 dias) e tardias (30 dias), a cepa C57/B6J mostra significante 

aumento da deposição de colágeno pelo método da hidroxiprolina em relação a 

cepa Balb/c (29). Somando se a esses resultados, a taxa de síntese de 

colágeno em cultura celular dos pulmões foi de 210% maior no C57/B6J em 

relação ao Balb/c (29). Essas diferenças refletem provavelmente distintos 

padrões de expressão de citocinas, de proteases e anti-proteases, de ativação 

e inativação enzimática e em última análise pelo perfil genético peculiar de 

cada cepa, determinando por fim características específicas na composição de 

matriz extracelular e de elementos contrateis responsáveis pela fibrose 

pulmonar (30, 31). 

Mecanismos de Lesão 

Na doença pulmonar fibrosante experimental, a unidade epitélio-

membrana basal, os capilares e o interstício septal encontram-se 

comprometidos (32, 33). O mecanismo de desenvolvimento das lesões 

compreende três etapas consecutivas. Primeiramente, o tecido pulmonar é 

danificado de alguma forma pelo agente conhecido (bleomicina, paraquat). Em 

segundo lugar, as paredes alveolares apresentam inflamação e finalmente, na 

terceira etapa, ocorre fibrose que começa no interstício pulmonar. Pelo 



� 18

comprometimento do interstício pulmonar, estas entidades produzem 

diminuição da distensibilidade, redução dos volumes pulmonares e da troca 

gasosa conseqüente destas duas primeiras alterações e da redução da 

capacidade de difusão da barreira alvéolo-capilar espessada. Todas as 

doenças pulmonares fibrosantes remodelam a arquitetura pulmonar, 

comprometendo as diferentes estruturas pulmonares e determinando, desta 

maneira, alterações funcionais qualitativas e quantitativas. São as principais 

vias de lesão: epitelial, vascular, matriz extracelular e alteração imuno-celular. 

Via Epitelial. A lesão das células epiteliais alveolares é um evento 

frequentemente observado nas doenças fibróticas pulmonares, sendo até 

agora um acontecimento pouco compreendido (34). Normalmente, a 

regeneração epitelial da parede alveolar é um evento crítico na restauração da 

integridade do parênquima alveolar. A falha na regeneração adequada pode 

levar a formação de uma cicatriz fibrótica irreversível e a perda da função 

pulmonar (35). A reepitelização imperfeita resultante da perda da capacidade 

proliferativa pode ser maior pelo aumento de apoptose ou pela inefetividade 

das células epiteliais para migrar ao sítio de lesão tecidual (35). A redução da 

capacidade de proliferação de pneumócitos tipo II e a impossibilidade destas 

células de diferenciar-se em pneumócitos tipo I são observadas nos processos 

de fibrose pulmonar humana e experimental (36). Os pneumócitos do tipo I são 

células vulneráveis a processos de injúria, ao contrário dos pneumócitos tipo II 

que são células de maior resistência (35, 37). Estas células proliferam e 

migram para recobrir a membrana basal exposta nos casos de lesão epitelial. 

Esta repopulação é feita caracteristicamente por células de aspecto 



� 19

cuboidiforme que posteriormente se diferenciam em pneumócitos do tipo II e I 

para restabelecer desta forma a função epitelial. Estudos sugerem que os 

pneumócitos tipo II em regiões lesadas podem dividir-se em duas 

subpopulações distintas de acordo com a expressão de E-caderina, que é 

responsável pela diferenciação celular e morfogênese (38, 39).  Uma 

subpopulação possuindo níveis baixos de E-caderina, maior resistência à 

injúria, maior poder proliferativo e maior atividade da telomerase, e outra com 

características contrárias a estas (39-41). As primeiras são supostamente a 

subpopulação de pneumócitos tipo II encarregados da regeneração do epitélio 

lesado e viriam a constituir células com características fisiopatológicas 

importantes nas doenças fibrosantes nas quais estariam caracteristicamente 

aumentadas e com alterações fenotípicas importantes (42, 43). Alterações 

nestas células, por conseguinte, podem comprometer a reepitelização alveolar 

dando lugar ao processo de fibrose. Por outro lado, o epitélio alveolar injuriado 

não apenas promove sinais ativadores para células mesenquimais, como 

também deixam de exercer sua função supressora sobre a multiplicação de 

fibroblastos, via produção de prostaglandinas E2 (PGE2) e derivados da 

ciclooxigenase COX–1 e principalmente COX–2, importante na produção dessa 

prostaglandina. Portanto, níveis reduzidos de PGE2 por injúria epitelial podem 

aumentar a proliferação, migração, contratibilidade e diferenciação dos 

fibroblastos para miofibroblastos e aumentar o processo fibrótico, mas a 

verdadeira participação destes processos ainda não é bem compreendida(44-

48). A ativação das células alveolares epiteliais provoca uma resposta pró-

fibrótica intensa, via liberação de fator de crescimento derivado de plaquetas, 

fator de crescimento transformador (TGF-�), fator de necrose tumoral (TNF-�), 



� 20

endotelina-1, fator de crescimento conjuntivo tissular, interleucinas (IL-4, IL-13) 

e osteoponina, que podem contribuir no processo fibrótico nas diferentes 

doenças fibrosantes(49) e em modelos experimentais induzidos por 

bleomicina(4, 50, 51). Um tipo semelhante de ativação exagerada das células 

epiteliais é visto de forma caracteristicamente semelhante nos processos de 

proliferação celular neoplásicos, à custa do aumento dos processos de 

ativação enzimática da telomerase celular (52). Repetições teloméricas 

fornecem a cada célula somática do corpo um mecanismo “relógio” que evita a 

proliferação ilimitada de células aberrantes em tecidos adultos. Devido às 

limitações do processo de replicação do DNA, que não é capaz de replicar 

adequadamente as extremidades 3´ dos cromossomos, após sucessivas 

gerações celulares, ocorre a erosão ou encurtamento crítico dos telômeros. Por 

conseguinte, estas células são removidas de modo permanentemente do ciclo 

celular e param de se dividir, um processo chamado de senescência celular 

replicativa (52). Em teoria, tal mecanismo poderia oferecer alguma segurança 

contra proliferação celular excessiva de células anormais em tecidos 

somáticos. Estudos demonstraram que a atividade da telomerase está 

aumentada em fibroblastos de pulmões sob efeito de bleomicina, apresentando 

uma alta capacidade de proliferação (41, 53, 54). Esta proliferação exagerada 

de fibroblastos pode estar ligada ao descontrole ou lesão da célula epitelial 

responsável pela estimulação da proliferação de fibroblastos ou pela ativação 

descontrolada anormal de proteínas profibróticas talvez por defeitos celulares 

inerentes à ativação contínua da telomerase em áreas de injúria tecidual (55). 

Por outro lado, a própria falha na replicação celular pode levar a apoptose das 

células epiteliais desencadeando um processo de desativação dos 



� 21

mecanismos reguladores da proliferação de fibroblastos aumentando o 

processo de depósito de fibras de colágeno (54). Uma melhor compreensão 

destes aspectos são importantes para o melhor entendimento dos processos 

fibróticos pulmonares. 

Via Vascular. Outro aspecto importante na patogênese das doenças 

pulmonares fibrosantes é o processo de angiogênese observado nestas 

doenças e que nos últimos anos tem adquirido um papel essencial para alguns 

mecanismos dos processos de cicatrização e fibroproliferativos que contribuem 

com a deposição de matriz extracelular (55, 56). A lesão da célula endotelial 

pode ativar o sistema imune e induzir a proliferação de fibroblastos contribuindo 

com o processo de fibrose. É importante sinalizar que existem evidências de 

um remodelamento vascular importante nos pacientes tanto in vivo (57) como 

em modelos de fibrose pulmonar induzido por bleomicina (58). Estas 

evidências aparentemente tem um papel fundamental e crítico na patogênese 

deste tipo de fibrose progressiva, levando a uma excessiva produção de 

colágeno e conseqüente remodelamento tecidual que pode induzir a ativação 

do sistema imune talvez perpetuando um ciclo fatal de fibrose (59). Por outro 

lado, a ativação de proteínas derivadas de angiotensina pode ser responsável 

pela ausência de capilares, característica principalmente vista nas áreas de 

lesão inicial (focos de fibroblastos) dos processos fibróticos (59). Relatos 

recentes em modelos experimentais de fibrose pulmonar induzido por 

bleomicina demonstram que a própria angiotensina II está implicada em 

processos fibróticos com importante papel vasoconstritor e sua disfunção pode 

provocar aumento do tônus vascular mediante a ativação de seus receptores 



� 22

AGTR tipo I e AGTR tipo II, interferindo na boa função endotelial ou 

aumentando a atividade dos miofibroblastos, provocando alterações 

vasculares, aumento da produção de colágeno e conseqüente perpetuação da 

fibrose (4, 60). Ao mesmo tempo, diversas evidências sugerem que existem 

deficiências na coagulação e na fibrinólise, e um desequilíbrio na produção de 

oxidantes e antioxidantes, que promovem a deposição extravascular de fibrina, 

presentes no compartimento alveolar dos casos de fibrose progressiva. 

Notadamente, células alveolares epiteliais parecem ter um papel fundamental 

na fisiopatologia por secretar fator tissular, o iniciador celular primário da 

cascata de coagulação, como o PAI-1 (inibidor do ativador de plasminogênio – 

1) (61, 62), por outro lado existem trabalhos que indicam um aumento da 

produção de oxidantes, aumentando a expressão de NOS (nitric oxide 

synthase) nas células endoteliais (62). A matriz extracelular provisória formada 

pela fibrina e pela fibronectina depositada no espaço alveolar após a lesão 

inicial pode desencadear reparação fibrótica, o que resultaria no 

remodelamento do septo alveolar (63). Os vasos linfáticos também contribuem 

nos processos de fibrose, além do transporte de líquidos, proteínas do tecido, 

transporte de células imunes e absorção de lipídeos, as alterações destas 

estruturas, podem contribuir no desbalanço das proteínas e outras 

macromoléculas reguladoras vasculares contribuindo com o aumento do 

edema ou da fibrose de uma determinada área lesada (64). Com base em 

nestes conhecimentos se faz importante uma melhor compreensão em 

modelos experimentais das características vasculares e vásculo-linfáticas nos 

processos fibróticos pulmonares. 



� 23

Via Matriz Extracelular. A excessiva e descontrolada deposição de proteínas 

da MEC causada pela proliferação e ativação dos fibroblastos chama a 

atenção, sendo um ponto crucial nos processos de fibrose pulmonar (65). 

Neste sentido, a regulação da biossíntese da matriz extracelular na fibrose 

pulmonar é alvo de muitos estudos. Mudanças arquiteturais intensas 

resultantes do aumento da espessura das paredes alveolares com perda das 

unidades alvéolos-capilares conduzem à insuficiência respiratória característica 

das doenças pulmonares fibrosantes (65). Uma característica chave do 

processo de fibrose pulmonar progressiva é a presença do aumento dos 

fibroblastos e miofibroblastos, evento crítico para o quadro da fibrose pulmonar 

(2, 4, 66). A partir do estabelecimento destas células nos alvéolos, 

modificações profundas ocorrem na morfologia do tecido pulmonar, sobretudo 

pela intensa deposição de componentes da matriz extracelular, principalmente 

colágeno. Há evidências que sugerem que os fibroblastos e miofibroblastos 

nestas áreas de proliferação são fonte principal para a expressão, depósito de 

matriz extracelular, ativação de interleucinas e células inflamatórias (2, 4, 67-

69). Outros autores tentam explicar a patogênese da fibrose pulmonar 

sugerindo participação da predisposição genética sob influência ambiental, com 

estímulo do sistema imune. A ativação do sistema imunológico pode causar 

lesão do endotélio vascular e proliferação de fibroblastos que estimularia à 

produção de colágeno. Em geral, o processo de fibrogênese secundário à 

lesão do tecido pulmonar é caracterizado por deposição de uma grande 

quantidade de colágenos fibrilares na matriz extracelular e pela desorganização 

morfológica das mesmas (70-72). Numerosos estudos confirmaram uma 

produção aumentada de vários componentes do tecido conjuntivo, incluindo 



� 24

colágenos I, III e VI, fibronectina, decorina e glicosaminoglicanos em processos 

fibrosantes (72, 73). Entre estes, os colágenos fibrilares e em particular o 

colágeno V tem sido implicado em vários processos de remodelamento e 

rejeição pulmonar nos últimos anos (74, 75). O colágeno V desempenha um 

papel fundamental nos processos de proliferação e reparação tecidual. A sua 

presença na membrana basal de vasos e em alguns tecidos mesenquimatosos 

é de extrema importância na ligação entre o colágeno IV da membrana basal e 

o conjuntivo frouxo dos órgãos (76), participa ativamente na interação dos 

componentes da MEC estabelecendo associação com outros tipos de 

colágeno, como os tipos I e III no interstício pulmonar (77, 78). Outro ponto 

importante no processo de fibrose é a participação da substância intersticial 

constituída pelos complexos de glicosaminoglicanas e pelas proteínas, 

denominadas proteoglicanas e glicoproteínas. A glicosaminoglicana mais 

comum e importante é o ácido hialurônico ou hialuronan, o qual apresenta 

várias funções principalmente ao influenciar a morfologia das fibrilas de 

colágeno, organizando e estabilizando-as (79). Sua interação com proteínas da 

matriz extracelular e com receptores da superfície celular podem regular muitos 

aspectos do comportamento das células, tais como a migração, a adesão 

célula-célula e a diferenciação celular (80, 81). Nas doenças fibrosantes 

pulmonares o ácido hialurônico pode aumentar a vida dos miofibroblastos e, 

por conseguinte perpetuar o contínuo depósito de fibras de colágeno na matriz 

extracelular. Estas alterações na síntese ou degradação do ácido hialurônico 

podem estar ligadas à alteração das hialuronidases, enzimas que degradam o 

ácido hialurônico (81-83). Os produtos originados da degradação do ácido 

hialurônico podem estimular a proliferação de células endoteliais, induzindo 



� 25

neoangiogênese como visto nos processos neoplásicos (83). A digestão da 

matriz extracelular pela hialuronidases pode liberar fatores de crescimento 

contidos no microambiente, alguns desses como o fator de crescimento 

endotelial vascular (VEGF) e o fator básico de crescimento de fibroblasto (FGF-

2) essenciais no crescimento celular e vascularização (83). Por outro lado, o 

ácido hialurônico de forma intacta pode atuar inibindo a neoangiogênese e 

consequentemente o crescimento desordenado das células (83). Alguns 

autores sugerem que citocinas como TGF-� e �, fator de crescimento derivado 

de plaquetas (PDGF), fator de crescimento epidérmico (EGF), fator de 

crescimento do tecido conjuntivo (CTGF), TNF-� e �, IL-1� e �, IL-4, IL-6, 

oncostatina e endotelina–1 regulem a proliferação de fibroblastos pulmonares e 

o depósito de matriz extracelular (84-86). Outros estudos evidenciam uma 

participação de outros fatores na regulação da produção de colágeno por 

citocinas o como o TNF-� e o interferon (IFN-�) (87). Estudos também tem 

apresentado um dominante papel para IL-13 na patogênese da fibrose 

pulmonar. Uma maior expressão de IL-13 no pulmão provoca em 

camundongos significante fibrose pela via subepitelial, mesmo na ausência de 

estímulos inflamatórios adicionais, enquanto o tratamento com anticorpos anti-

IL-13 reduzem a deposição de colágeno nos pulmões de animais que foram 

induzidos com bleomicina (2, 4, 88). É possível que estas substâncias da 

matriz extracelular juntamente com o colágeno V, tenham um papel importante 

no processo fibrótico pulmonar, modulando as propriedades biomecânicas das 

fibrilas de colágeno, gerando desestruturação e aumento da sua síntese, 

contribuindo no processo de fibrose.  



� 26

 O colágeno V é um componente da membrana basal, membrana 

sinovial, cartilagem articular hialina, placenta e ao redor das células musculares 

lisas vasculares (77, 78, 89). Ele difere dos outros colágenos por apresentar 

terminações NH2 e COOH na sua molécula e retenção de grande parte de N-

propeptídeos na molécula madura, o que a torna mais imunogênica (77, 78, 

90). Além disso, o colageno V não é normalmente exposto nos tecidos, já que 

ele é encontrado entre os colágenos I e III, formando fibras heterotípicas, 

exceto na córnea (78, 89), e assim, mantendo a integridade da matriz 

extracelular e regulando o diâmetro da fibra de colágeno (91-94). As fibras 

heterotípicas, de colágeno I e V, encobrem a região helicoidal da molécula de 

colágeno V, fazendo com que estes epítopos sejam escondidos e  inacessíveis 

(78). 

 Estudos demonstram que a fibrose pulmonar, de pele e gastrointestinal 

provém de disfunção endotelial (95), ativação do sistema imune (96), 

proliferação de fibroblastos e síntese excessiva de colágeno V anormal (96-99). 

O colágeno V também está envolvido na patogênese de rejeição experimental 

de pulmão (74, 75, 100) e bronquiolite obliterante em pulmão de ratos por 

tolerância oral induzida por colágeno V (101), além de ter um importante papel 

nos processos de proliferação e remodelamento (102).  

 Assim, pode haver pelo menos 2 mecanismos fisiopatológicos da 

participação do colágeno V no processo de fibrose pulmonar: 1) A ligação 

direta de epítopos do colágeno V em receptores celulares, aumentando a 

síntese de colágeno por fibroblastos e miofibroblastos; 2) Injúria prolongada 

poderia provocar lesão da membrana basal e exposição de epítopos internos 

de colágeno V, originando neoantígenos, podendo atuar no desencadeamento 



� 27

de doenças auto-imunes. Isso pode ser corroborado pela presença de 

anticorpos anti-colágeno V no soro de coelhos imunizados com colágeno V 

(103) e pela ativação da resposta imune inata pelas células TH17 colágeno V 

específicas em disfunção primária no enxerto de transplate pulmonar (104). O 

estudo e a compreensão dos mecanismos vinculados com o aumento de fibras 

colágenas, das células que intervém na sua produção e da análise funcional 

nos mecanismos da fibrose pulmonar mostra-se como uma chave para 

compreender melhor a patogênese destas doenças pulmonares fibróticas. 

Via Imuno-celular. A fibrose pulmonar é oriunda de um processo inflamatório 

crônico, que além da fibrose mostra um infiltrado mononuclear, cuja principal 

célula é o linfócito. Estes são atraídos ao local de injúria e são ativados por 

vários antígenos, sendo assim estimulados a produzirem citocinas e 

progredirem com o processo inflamatório. No entanto, a fibrose pulmonar nem 

sempre apresenta persistência da inflamação (18). E este fato é associado ao 

desenvolvimento de uma resposta celular TH2 (IL-4, IL-5, Il13 e IL21) (2, 4). No 

entanto, pela análise desses podemos encontrar evidências de outros 

mecanismos a este padrão de resposta, podendo ser um mecanismo paralelo 

ou subjacente. 

 Em contraste ao padrão TH1 e TH2 introduzido por Mosmann & Coffman 

(105) há 25 anos atrás, estabeleceu-se um novo padrão de células T auxiliares 

pela caracterização de fatores de diferenciação e transcrição únicos da 

chamada célula TH17 (106, 107). A descoberta da cadeia de citocina p19 no 

ano de 2000 permitiu identificar um nova citocina, chamada de IL-23, quando 

esta formava heterodímeros com a cadeia p40 da IL-12 (108).  Assim, após 

estudos comprobatórios, ficou claro que a IL-23 e não a IL-12 esta envolvida 



� 28

em doenças autoimunes e processos inflamatórios intensos. Em estudos de 

seguimento, mostrou-se que a IL-23 expande e mantém a diferenciação de 

células produtoras de IL-17 (109). Entretanto, o fator de diferenciação inicial foi 

demonstrado ser o TGF-�. Sob influência desta citocina, a celula T naive 

mostra expressão da forkhead box p3 (Foxp3), originando a célula T reguladora 

CD25+CD4+Foxp3+ (célula Treg), a qual é supressora da resposta imune. Mas 

sobre a ação da IL-6, pela via STAT3, há liberação da função da RORc, a qual 

é fisicamente associada a Foxp3 e também induzida pelo TGF-� (110-112). 

Então o TGF-� e a IL-6 induzem a RORc e este induz o programa transcricional 

da IL17 (113, 114). A IL-21 exerce o efeito da IL-6, quando o nível da IL-6 é 

baixo, mantendo e amplificando o reservatório de precursores de células IL-17, 

por exemplo na ausência de inflamação (115-117). O efeito da IL-6 ou IL-21 

mais TGF-� sobre a RORc e STAT3 também promove a expressão do receptor 

de IL-23 (IL-23R) (110, 116, 118). A disponibilidade de IL-23 é essencial para 

completar e sustentar a diferenciação da célula TH17, sendo um fator limitante 

da resposta TH17 (119, 120). Como a IL-23 é produzida pelos macrófagos e 

células dendríticas, estas células apresentam o colágeno ao sistema imune e 

desencadeiam a resposta TH17, como demonstrado nos estudos iniciais sobre 

TH17 associados a doenças autoimunes (121-123). Após a indução pela 

RORc, a IL-17A (IL-17) é produzida na célula TH17. Várias outras células 

também produzem IL-17 (células T ��, células NK, neutrófilos, células do 

sistema inato, eosinófilos) (124-126). E seus efeitos são proinflamatórios (127), 

induzindo a expressão de citocinas (TNF, IL-1�, IL-6, GMCSF, G-CSF), 

quimiocinas (CXCL1, CXCL8, CXCL10), metaloproteinases (128-130), fatores 

chaves no recrutamento, ativação e migração de neutrófilos (130, 131), além 



� 29

de propriedades quimiotáxicas (132). O receptor de IL-17 (IL-17RA) pode 

formar um heterodímero com o receptor de IL-25 (IL-17RB) e assim pode 

contribuir tanto para uma resposta inflamatória TH17 dependente como uma 

resposta TH2 via sinalização pela IL-25 (129, 133-138). No entanto, a 

sinalização IL-25 induz a expressão de IL-13 e IL-5, os quais inibem a 

expressão de IL-23, fator chave da resposta IL-17 (137). 

 Desta forma, num estudo recente, a gravidade da Fibrose Pulmonar 

Idiopática é relacionada a diminuição das Tregs (139) e em  estudos de fibrose 

hepática e pulmonar, mostra-se que a sinalização via IL-21 e IL-13 promove 

fibrose (140-144), porém a relação e/ou influência TH17 é desconhecida. 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



� 30

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

2. REFERÊNCIAS BIBLIOGRÁFICAS 



� 31

 

1. Huaux F, Arras M, Tomasi D, Barbarin V, Delos M, Coutelier JP, Vink A, 

Phan SH, Renauld JC, Lison D. A profibrotic function of il-12p40 in experimental 

pulmonary fibrosis. Journal of immunology 2002;169:2653-2661. 

2. Fernandez IE, Eickelberg O. New cellular and molecular mechanisms of 

lung injury and fibrosis in idiopathic pulmonary fibrosis. Lancet 2012;380:680-

688. 

3. Raghu G, Collard HR, Egan JJ, Martinez FJ, Behr J, Brown KK, Colby 

TV, Cordier JF, Flaherty KR, Lasky JA, Lynch DA, Ryu JH, Swigris JJ, Wells 

AU, Ancochea J, Bouros D, Carvalho C, Costabel U, Ebina M, Hansell DM, 

Johkoh T, Kim DS, King TE, Jr., Kondoh Y, Myers J, Muller NL, Nicholson AG, 

Richeldi L, Selman M, Dudden RF, Griss BS, Protzko SL, Schunemann HJ, 

Fibrosis AEJACoIP. An official ats/ers/jrs/alat statement: Idiopathic pulmonary 

fibrosis: Evidence-based guidelines for diagnosis and management. American 

journal of respiratory and critical care medicine 2011;183:788-824. 

4. Wynn TA. Cellular and molecular mechanisms of fibrosis. The Journal of 

pathology 2008;214:199-210. 

5. Goldstein RH, Fine A. Potential therapeutic initiatives for fibrogenic lung 

diseases. Chest 1995;108:848-855. 

6. Crystal RG, Gadek JE, Ferrans VJ, Fulmer JD, Line BR, Hunninghake 

GW. Interstitial lung disease: Current concepts of pathogenesis, staging and 

therapy. The American journal of medicine 1981;70:542-568. 

7. Gauldie J, Kolb M. Animal models of pulmonary fibrosis: How far from 

effective reality? American journal of physiology Lung cellular and molecular 

physiology 2008;294:L151. 



� 32

8. Moore BB, Hogaboam CM. Murine models of pulmonary fibrosis. 

American journal of physiology Lung cellular and molecular physiology 

2008;294:L152-160. 

9. Umezawa H, Ishizuka M, Maeda K, Takeuchi T. Studies on bleomycin. 

Cancer 1967;20:891-895. 

10. Bowden DH. Unraveling pulmonary fibrosis: The bleomycin model. 

Laboratory investigation; a journal of technical methods and pathology 

1984;50:487-488. 

11. Ishizuka M, Takayama H, Takeuchi T, Umezawa H. Activity and toxicity of 

bleomycin. The Journal of antibiotics 1967;20:15-24. 

12. Chen J, Ziboh V, Giri SN. Up-regulation of platelet-activating factor 

receptors in lung and alveolar macrophages in the bleomycin-hamster model of 

pulmonary fibrosis. The Journal of pharmacology and experimental therapeutics 

1997;280:1219-1227. 

13. Hay J, Shahzeidi S, Laurent G. Mechanisms of bleomycin-induced lung 

damage. Archives of toxicology 1991;65:81-94. 

14. Tsuda E, Goto M, Mochizuki S, Yano K, Kobayashi F, Morinaga T, 

Higashio K. Isolation of a novel cytokine from human fibroblasts that specifically 

inhibits osteoclastogenesis. Biochemical and biophysical research 

communications 1997;234:137-142. 

15. Berend N. Protective effect of hypoxia on bleomycin lung toxicity in the 

rat. The American review of respiratory disease 1984;130:307-308. 

16. Sausville EA, Stein RW, Peisach J, Horwitz SB. Properties and products 

of the degradation of DNA by bleomycin and iron(ii). Biochemistry 

1978;17:2746-2754. 



� 33

17. Burger RM, Peisach J, Blumberg WE, Horwitz SB. Iron-bleomycin 

interactions with oxygen and oxygen analogues. Effects on spectra and drug 

activity. The Journal of biological chemistry 1979;254:10906-10912. 

18. Chandler DB, Hyde DM, Giri SN. Morphometric estimates of infiltrative 

cellular changes during the development of bleomycin-induced pulmonary 

fibrosis in hamsters. The American journal of pathology 1983;112:170-177. 

19. Jones AW. Bleomycin lung damage: The pathology and nature of the 

lesion. British journal of diseases of the chest 1978;72:321-326. 

20. Phan SH, Thrall RS. The role of soluble factors in bleomycin-induced 

pulmonary fibrosis. The American journal of pathology 1982;106:156-164. 

21. Catravas JD, Lazo JS, Dobuler KJ, Mills LR, Gillis CN. Pulmonary 

endothelial dysfunction in the presence or absence of interstitial injury induced 

by intratracheally injected bleomycin in rabbits. The American review of 

respiratory disease 1983;128:740-746. 

22. Piguet PF, Kaufman S, Barazzone C, Muller M, Ryffel B, Eugster HP. 

Resistance of tnf/lt alpha double deficient mice to bleomycin-induced fibrosis. 

International journal of experimental pathology 1997;78:43-48. 

23. Luna MA, Bedrossian CW, Lichtiger B, Salem PA. Interstitial pneumonitis 

associated with bleomycin therapy. American journal of clinical pathology 

1972;58:501-510. 

24. Honore P, Hantson P, Fauville JP, Peeters A, Manieu P. Paraquat 

poisoning. "State of the art". Acta clinica Belgica 1994;49:220-228. 

25. Quinlan T, Spivack S, Mossman BT. Regulation of antioxidant enzymes in 

lung after oxidant injury. Environmental health perspectives 1994;102 Suppl 

2:79-87. 



� 34

26. Smith P, Heath D. The ultrastructure and time sequence of the early 

stages of paraquat lung in rats. The Journal of pathology 1974;114:177-184. 

27. Ishida Y, Takayasu T, Kimura A, Hayashi T, Kakimoto N, Miyashita T, 

Kondo T. Gene expression of cytokines and growth factors in the lungs after 

paraquat administration in mice. Legal medicine 2006;8:102-109. 

28. Thompson WD, Patrick RS. Collagen prolyl hydroxylase levels in 

experimental paraquat poisoning. British journal of experimental pathology 

1978;59:288-291. 

29. Schrier DJ, Kunkel RG, Phan SH. The role of strain variation in murine 

bleomycin-induced pulmonary fibrosis. The American review of respiratory 

disease 1983;127:63-66. 

30. Faffe DS, D'Alessandro ES, Xisto DG, Antunes MA, Romero PV, Negri 

EM, Rodrigues NR, Capelozzi VL, Zin WA, Rocco PR. Mouse strain 

dependence of lung tissue mechanics: Role of specific extracellular matrix 

composition. Respiratory physiology & neurobiology 2006;152:186-196. 

31. Phan SH, Kunkel SL. Lung cytokine production in bleomycin-induced 

pulmonary fibrosis. Experimental lung research 1992;18:29-43. 

32. American Thoracic S, European Respiratory S. American thoracic 

society/european respiratory society international multidisciplinary consensus 

classification of the idiopathic interstitial pneumonias. This joint statement of the 

american thoracic society (ats), and the european respiratory society (ers) was 

adopted by the ats board of directors, june 2001 and by the ers executive 

committee, june 2001. American journal of respiratory and critical care medicine 

2002;165:277-304. 



� 35

33. Costabel U, King TE. International consensus statement on idiopathic 

pulmonary fibrosis. The European respiratory journal : official journal of the 

European Society for Clinical Respiratory Physiology 2001;17:163-167. 

34. Baptista AL, Parra ER, Filho JV, Kairalla RA, de Carvalho CR, Capelozzi 

VL. Structural features of epithelial remodeling in usual interstitial pneumonia 

histologic pattern. Lung 2006;184:239-244. 

35. Selman M, Pardo A. Role of epithelial cells in idiopathic pulmonary 

fibrosis: From innocent targets to serial killers. Proceedings of the American 

Thoracic Society 2006;3:364-372. 

36. Kuwano K, Hagimoto N, Tanaka T, Kawasaki M, Kunitake R, Miyazaki H, 

Kaneko Y, Matsuba T, Maeyama T, Hara N. Expression of apoptosis-regulatory 

genes in epithelial cells in pulmonary fibrosis in mice. The Journal of pathology 

2000;190:221-229. 

37. Jacinto A, Martinez-Arias A, Martin P. Mechanisms of epithelial fusion 

and repair. Nature cell biology 2001;3:E117-123. 

38. Reddy R, Buckley S, Doerken M, Barsky L, Weinberg K, Anderson KD, 

Warburton D, Driscoll B. Isolation of a putative progenitor subpopulation of 

alveolar epithelial type 2 cells. American journal of physiology Lung cellular and 

molecular physiology 2004;286:L658-667. 

39. McGuire JK, Li Q, Parks WC. Matrilysin (matrix metalloproteinase-7) 

mediates e-cadherin ectodomain shedding in injured lung epithelium. The 

American journal of pathology 2003;162:1831-1843. 

40. Douglas IS, Diaz del Valle F, Winn RA, Voelkel NF. Beta-catenin in the 

fibroproliferative response to acute lung injury. American journal of respiratory 

cell and molecular biology 2006;34:274-285. 



� 36

41. Liu T, Chung MJ, Ullenbruch M, Yu H, Jin H, Hu B, Choi YY, Ishikawa F, 

Phan SH. Telomerase activity is required for bleomycin-induced pulmonary 

fibrosis in mice. The Journal of clinical investigation 2007;117:3800-3809. 

42. Turner-Warwick M, Burrows B, Johnson A. Cryptogenic fibrosing 

alveolitis: Clinical features and their influence on survival. Thorax 1980;35:171-

180. 

43. Willis BC, duBois RM, Borok Z. Epithelial origin of myofibroblasts during 

fibrosis in the lung. Proceedings of the American Thoracic Society 2006;3:377-

382. 

44. Ghosh M, Stewart A, Tucker DE, Bonventre JV, Murphy RC, Leslie CC. 

Role of cytosolic phospholipase a(2) in prostaglandin e(2) production by lung 

fibroblasts. American journal of respiratory cell and molecular biology 

2004;30:91-100. 

45. Lovgren AK, Jania LA, Hartney JM, Parsons KK, Audoly LP, Fitzgerald 

GA, Tilley SL, Koller BH. Cox-2-derived prostacyclin protects against 

bleomycin-induced pulmonary fibrosis. American journal of physiology Lung 

cellular and molecular physiology 2006;291:L144-156. 

46. Lama V, Moore BB, Christensen P, Toews GB, Peters-Golden M. 

Prostaglandin e2 synthesis and suppression of fibroblast proliferation by 

alveolar epithelial cells is cyclooxygenase-2-dependent. American journal of 

respiratory cell and molecular biology 2002;27:752-758. 

47. Hodges RJ, Jenkins RG, Wheeler-Jones CP, Copeman DM, Bottoms SE, 

Bellingan GJ, Nanthakumar CB, Laurent GJ, Hart SL, Foster ML, McAnulty RJ. 

Severity of lung injury in cyclooxygenase-2-deficient mice is dependent on 



� 37

reduced prostaglandin e(2) production. The American journal of pathology 

2004;165:1663-1676. 

48. Card JW, Voltz JW, Carey MA, Bradbury JA, Degraff LM, Lih FB, Bonner 

JC, Morgan DL, Flake GP, Zeldin DC. Cyclooxygenase-2 deficiency 

exacerbates bleomycin-induced lung dysfunction but not fibrosis. American 

journal of respiratory cell and molecular biology 2007;37:300-308. 

49. Atamas SP, White B. Cytokine regulation of pulmonary fibrosis in 

scleroderma. Cytokine & growth factor reviews 2003;14:537-550. 

50. Murray LA, Argentieri RL, Farrell FX, Bracht M, Sheng H, Whitaker B, 

Beck H, Tsui P, Cochlin K, Evanoff HL, Hogaboam CM, Das AM. Hyper-

responsiveness of ipf/uip fibroblasts: Interplay between tgfbeta1, il-13 and ccl2. 

The international journal of biochemistry & cell biology 2008;40:2174-2182. 

51. Takahashi F, Takahashi K, Okazaki T, Maeda K, Ienaga H, Maeda M, 

Kon S, Uede T, Fukuchi Y. Role of osteopontin in the pathogenesis of 

bleomycin-induced pulmonary fibrosis. American journal of respiratory cell and 

molecular biology 2001;24:264-271. 

52. Lantuejoul S, Salon C, Soria JC, Brambilla E. Telomerase expression in 

lung preneoplasia and neoplasia. International journal of cancer Journal 

international du cancer 2007;120:1835-1841. 

53. Nozaki Y, Liu T, Hatano K, Gharaee-Kermani M, Phan SH. Induction of 

telomerase activity in fibroblasts from bleomycin-injured lungs. American journal 

of respiratory cell and molecular biology 2000;23:460-465. 

54. Fridlender ZG, Cohen PY, Golan O, Arish N, Wallach-Dayan S, Breuer R. 

Telomerase activity in bleomycin-induced epithelial cell apoptosis and lung 



� 38

fibrosis. The European respiratory journal : official journal of the European 

Society for Clinical Respiratory Physiology 2007;30:205-213. 

55. Parra ER, Silverio da Costa LR, Ab'Saber A, Ribeiro de Carvalho CR, 

Kairalla RA, Fernezlian SM, Teixeira LR, Capelozzi VL. Nonhomogeneous 

density of cd34 and vcam-1 alveolar capillaries in major types of idiopathic 

interstitial pneumonia. Lung 2005;183:363-373. 

56. Parra ER, David YR, da Costa LR, Ab'Saber A, Sousa R, Kairalla RA, de 

Carvalho CR, Filho MT, Capelozzi VL. Heterogeneous remodeling of lung 

vessels in idiopathic pulmonary fibrosis. Lung 2005;183:291-300. 

57. Gracey DR, Divertie MB, Brown AL, Jr. Alveolar-capillary membrane in 

idiopathic interstitial pulmonary fibrosis. Electron microscopic study of 14 cases. 

The American review of respiratory disease 1968;98:16-21. 

58. Hamada N, Kuwano K, Yamada M, Hagimoto N, Hiasa K, Egashira K, 

Nakashima N, Maeyama T, Yoshimi M, Nakanishi Y. Anti-vascular endothelial 

growth factor gene therapy attenuates lung injury and fibrosis in mice. Journal 

of immunology 2005;175:1224-1231. 

59. Renzoni EA, Walsh DA, Salmon M, Wells AU, Sestini P, Nicholson AG, 

Veeraraghavan S, Bishop AE, Romanska HM, Pantelidis P, Black CM, Du Bois 

RM. Interstitial vascularity in fibrosing alveolitis. American journal of respiratory 

and critical care medicine 2003;167:438-443. 

60. Waseda Y, Yasui M, Nishizawa Y, Inuzuka K, Takato H, Ichikawa Y, 

Tagami A, Fujimura M, Nakao S. Angiotensin ii type 2 receptor antagonist 

reduces bleomycin-induced pulmonary fibrosis in mice. Respiratory research 

2008;9:43. 



� 39

61. Kotani I, Sato A, Hayakawa H, Urano T, Takada Y, Takada A. Increased 

procoagulant and antifibrinolytic activities in the lungs with idiopathic pulmonary 

fibrosis. Thrombosis research 1995;77:493-504. 

62. Saleh D, Barnes PJ, Giaid A. Increased production of the potent oxidant 

peroxynitrite in the lungs of patients with idiopathic pulmonary fibrosis. 

American journal of respiratory and critical care medicine 1997;155:1763-1769. 

63. Moore BB, Peters-Golden M, Christensen PJ, Lama V, Kuziel WA, Paine 

R, 3rd, Toews GB. Alveolar epithelial cell inhibition of fibroblast proliferation is 

regulated by mcp-1/ccr2 and mediated by pge2. American journal of physiology 

Lung cellular and molecular physiology 2003;284:L342-349. 

64. Crystal RG, Fulmer JD, Baum BJ, Bernardo J, Bradley KH, Bruel SD, 

Elson NA, Fells GA, Ferrans VJ, Gadek JE, Hunninghake GW, Kawanami O, 

Kelman JA, Line BR, McDonald JA, McLees BD, Roberts WC, Rosenberg DM, 

Tolstoshev P, Von Gal E, Weinberger SE. Cells, collagen and idiopathic 

pulmonary fibrosis. Lung 1978;155:199-224. 

65. Fukuda Y, Basset F, Ferrans VJ, Yamanaka N. Significance of early intra-

alveolar fibrotic lesions and integrin expression in lung biopsy specimens from 

patients with idiopathic pulmonary fibrosis. Human pathology 1995;26:53-61. 

66. Krieg T, Abraham D, Lafyatis R. Fibrosis in connective tissue disease: 

The role of the myofibroblast and fibroblast-epithelial cell interactions. Arthritis 

research & therapy 2007;9 Suppl 2:S4. 

67. Hakelien AM, Landsverk HB, Robl JM, Skalhegg BS, Collas P. 

Reprogramming fibroblasts to express t-cell functions using cell extracts. Nature 

biotechnology 2002;20:460-466. 



� 40

68. Dzau VJ, Gibbons GH. Vascular remodeling: Mechanisms and 

implications. Journal of cardiovascular pharmacology 1993;21 Suppl 1:S1-5. 

69. Paine R, 3rd, Ward PA. Cell adhesion molecules and pulmonary fibrosis. 

The American journal of medicine 1999;107:268-279. 

70. Nishiyama T, McDonough AM, Bruns RR, Burgeson RE. Type xii and xiv 

collagens mediate interactions between banded collagen fibers in vitro and may 

modulate extracellular matrix deformability. The Journal of biological chemistry 

1994;269:28193-28199. 

71. Walchli C, Koch M, Chiquet M, Odermatt BF, Trueb B. Tissue-specific 

expression of the fibril-associated collagens xii and xiv. Journal of cell science 

1994;107 ( Pt 2):669-681. 

72. Shahzeidi S, Mulier B, de Crombrugghe B, Jeffery PK, McAnulty RJ, 

Laurent GJ. Enhanced type iii collagen gene expression during bleomycin 

induced lung fibrosis. Thorax 1993;48:622-628. 

73. Mariani TJ, Roby JD, Mecham RP, Parks WC, Crouch E, Pierce RA. 

Localization of type i procollagen gene expression in silica-induced 

granulomatous lung disease and implication of transforming growth factor-beta 

as a mediator of fibrosis. The American journal of pathology 1996;148:151-164. 

74. Haque MA, Mizobuchi T, Yasufuku K, Fujisawa T, Brutkiewicz RR, Zheng 

Y, Woods K, Smith GN, Cummings OW, Heidler KM, Blum JS, Wilkes DS. 

Evidence for immune responses to a self-antigen in lung transplantation: Role 

of type v collagen-specific t cells in the pathogenesis of lung allograft rejection. 

Journal of immunology 2002;169:1542-1549. 

75. Yasufuku K, Heidler KM, Woods KA, Smith GN, Jr., Cummings OW, 

Fujisawa T, Wilkes DS. Prevention of bronchiolitis obliterans in rat lung 



� 41

allografts by type v collagen-induced oral tolerance. Transplantation 

2002;73:500-505. 

76. Aumailley M, Timpl R. Attachment of cells to basement membrane 

collagen type iv. The Journal of cell biology 1986;103:1569-1575. 

77. Adachi E, Hopkinson I, Hayashi T. Basement-membrane stromal 

relationships: Interactions between collagen fibrils and the lamina densa. 

International review of cytology 1997;173:73-156. 

78. Linsenmayer TF, Fitch JM, Birk DE. Heterotypic collagen fibrils and 

stabilizing collagens. Controlling elements in corneal morphogenesis? Annals of 

the New York Academy of Sciences 1990;580:143-160. 

79. Laurent TC, Fraser JR. Hyaluronan. FASEB journal : official publication of 

the Federation of American Societies for Experimental Biology 1992;6:2397-

2404. 

80. Knudson CB, Knudson W. Hyaluronan and cd44: Modulators of 

chondrocyte metabolism. Clinical orthopaedics and related research 

2004:S152-162. 

81. Knudson W, Chow G, Knudson CB. Cd44-mediated uptake and 

degradation of hyaluronan. Matrix biology : journal of the International Society 

for Matrix Biology 2002;21:15-23. 

82. Tammi MI, Day AJ, Turley EA. Hyaluronan and homeostasis: A balancing 

act. The Journal of biological chemistry 2002;277:4581-4584. 

83. Lokeshwar VB, Selzer MG. Differences in hyaluronic acid-mediated 

functions and signaling in arterial, microvessel, and vein-derived human 

endothelial cells. The Journal of biological chemistry 2000;275:27641-27649. 



� 42

84. Silvera MR, Sempowski GD, Phipps RP. Expression of tgf-beta isoforms 

by thy-1+ and thy-1- pulmonary fibroblast subsets: Evidence for tgf-beta as a 

regulator of il-1-dependent stimulation of il-6. Lymphokine and cytokine 

research 1994;13:277-285. 

85. Roberts AB, Russo A, Felici A, Flanders KC. Smad3: A key player in 

pathogenetic mechanisms dependent on tgf-beta. Annals of the New York 

Academy of Sciences 2003;995:1-10. 

86. Kenyon NJ, Ward RW, McGrew G, Last JA. Tgf-beta1 causes airway 

fibrosis and increased collagen i and iii mrna in mice. Thorax 2003;58:772-777. 

87. Granstein RD, Flotte TJ, Amento EP. Interferons and collagen production. 

The Journal of investigative dermatology 1990;95:75S-80S. 

88. Cortijo J, Cerda-Nicolas M, Serrano A, Bioque G, Estrela JM, Santangelo 

F, Esteras A, Llombart-Bosch A, Morcillo EJ. Attenuation by oral n-

acetylcysteine of bleomycin-induced lung injury in rats. The European 

respiratory journal : official journal of the European Society for Clinical 

Respiratory Physiology 2001;17:1228-1235. 

89. Niyibizi C, Fietzek PP, van der Rest M. Human placenta type v collagens. 

Evidence for the existence of an alpha 1(v) alpha 2(v) alpha 3(v) collagen 

molecule. The Journal of biological chemistry 1984;259:14170-14174. 

90. Andrikopoulos K, Liu X, Keene DR, Jaenisch R, Ramirez F. Targeted 

mutation in the col5a2 gene reveals a regulatory role for type v collagen during 

matrix assembly. Nature genetics 1995;9:31-36. 

91. Adachi E, Hayashi T. In vitro formation of hybrid fibrils of type v collagen 

and type i collagen. Limited growth of type i collagen into thick fibrils by type v 

collagen. Connective tissue research 1986;14:257-266. 



� 43

92. Burrows NP, Nicholls AC, Yates JR, Gatward G, Sarathachandra P, 

Richards A, Pope FM. The gene encoding collagen alpha1(v)(col5a1) is linked 

to mixed ehlers-danlos syndrome type i/ii. The Journal of investigative 

dermatology 1996;106:1273-1276. 

93. Michalickova K, Susic M, Willing MC, Wenstrup RJ, Cole WG. Mutations 

of the alpha2(v) chain of type v collagen impair matrix assembly and produce 

ehlers-danlos syndrome type i. Human molecular genetics 1998;7:249-255. 

94. Birk DE. Type v collagen: Heterotypic type i/v collagen interactions in the 

regulation of fibril assembly. Micron 2001;32:223-237. 

95. Parra ER, Aguiar AC, Jr., Teodoro WR, de Souza R, Yoshinari NH, 

Capelozzi VL. Collagen v and vascular injury promote lung architectural 

changes in systemic sclerosis. The clinical respiratory journal 2009;3:135-142. 

96. Callado MR, Viana VS, Vendramini MB, Leon EP, Bueno C, Velosa AP, 

Teodoro WR, Yoshinari NH. Autoantibody profile in the experimental model of 

scleroderma induced by type v human collagen. Immunology 2007;122:38-46. 

97. Parra ER, Teodoro WR, de Morais J, Katayama ML, de Souza R, 

Yoshinari NH, Capelozzi VL. Increased mrna expression of collagen v gene in 

pulmonary fibrosis of systemic sclerosis. European journal of clinical 

investigation 2010;40:110-120. 

98. Teodoro WR, Velosa AP, Witzel SS, Garippo AL, Farhat C, Parra ER, 

Sonohara S, Capelozzi VL, Yoshinari NH. Architectural remodelling in lungs of 

rabbits induced by type v collagen immunization: A preliminary morphologic 

model to study diffuse connective tissue diseases. Pathology, research and 

practice 2004;200:681-691. 



� 44

99. Martin P, Teodoro WR, Velosa AP, de Morais J, Carrasco S, Christmann 

RB, Goldenstein-Schainberg C, Parra ER, Katayama ML, Sotto MN, Capelozzi 

VL, Yoshinari NH. Abnormal collagen v deposition in dermis correlates with skin 

thickening and disease activity in systemic sclerosis. Autoimmunity reviews 

2012;11:827-835. 

100. Sumpter TL, Wilkes DS. Role of autoimmunity in organ allograft rejection: 

A focus on immunity to type v collagen in the pathogenesis of lung transplant 

rejection. American journal of physiology Lung cellular and molecular 

physiology 2004;286:L1129-1139. 

101. Yasufuku K, Heidler KM, O'Donnell PW, Smith GN, Jr., Cummings OW, 

Foresman BH, Fujisawa T, Wilkes DS. Oral tolerance induction by type v 

collagen downregulates lung allograft rejection. American journal of respiratory 

cell and molecular biology 2001;25:26-34. 

102. Garippo A, Parra E, Teodoro W, Rivero D, Souza F, Yoshinari N, 

Capelozzi V. Nasal tolerance with collagen v protein reverts bronchovascular 

axis remodeling in experimental bronchiolitis obliterans. Clinics 2007;62:499-

506. 

103. Ogido LT, Teodoro WR, Velosa AP, de Oliveira CC, Parra ER, Capelozzi 

VL, Yoshinari NH. Abnormal collagen deposition in synovia after collagen type v 

immunization in rabbits. Histology and histopathology 2008;23:263-269. 

104. Bobadilla JL, Love RB, Jankowska-Gan E, Xu Q, Haynes LD, Braun RK, 

Hayney MS, Munoz del Rio A, Meyer K, Greenspan DS, Torrealba J, Heidler 

KM, Cummings OW, Iwata T, Brand D, Presson R, Burlingham WJ, Wilkes DS. 

Th-17, monokines, collagen type v, and primary graft dysfunction in lung 



� 45

transplantation. American journal of respiratory and critical care medicine 

2008;177:660-668. 

105. Mosmann TR, Coffman RL. Th1 and th2 cells: Different patterns of 

lymphokine secretion lead to different functional properties. Annual review of 

immunology 1989;7:145-173. 

106. Korn T, Bettelli E, Oukka M, Kuchroo VK. Il-17 and th17 cells. Annual 

review of immunology 2009;27:485-517. 

107. Bettelli E, Korn T, Oukka M, Kuchroo VK. Induction and effector functions 

of t(h)17 cells. Nature 2008;453:1051-1057. 

108. Oppmann B, Lesley R, Blom B, Timans JC, Xu Y, Hunte B, Vega F, Yu N, 

Wang J, Singh K, Zonin F, Vaisberg E, Churakova T, Liu M, Gorman D, Wagner 

J, Zurawski S, Liu Y, Abrams JS, Moore KW, Rennick D, de Waal-Malefyt R, 

Hannum C, Bazan JF, Kastelein RA. Novel p19 protein engages il-12p40 to 

form a cytokine, il-23, with biological activities similar as well as distinct from il-

12. Immunity 2000;13:715-725. 

109. Langrish CL, Chen Y, Blumenschein WM, Mattson J, Basham B, 

Sedgwick JD, McClanahan T, Kastelein RA, Cua DJ. Il-23 drives a pathogenic t 

cell population that induces autoimmune inflammation. The Journal of 

experimental medicine 2005;201:233-240. 

110. Zhou L, Ivanov, II, Spolski R, Min R, Shenderov K, Egawa T, Levy DE, 

Leonard WJ, Littman DR. Il-6 programs t(h)-17 cell differentiation by promoting 

sequential engagement of the il-21 and il-23 pathways. Nature immunology 

2007;8:967-974. 



� 46

111. Veldhoen M, Hocking RJ, Atkins CJ, Locksley RM, Stockinger B. Tgfbeta 

in the context of an inflammatory cytokine milieu supports de novo 

differentiation of il-17-producing t cells. Immunity 2006;24:179-189. 

112. Du J, Huang C, Zhou B, Ziegler SF. Isoform-specific inhibition of ror 

alpha-mediated transcriptional activation by human foxp3. Journal of 

immunology 2008;180:4785-4792. 

113. Zhou L, Lopes JE, Chong MM, Ivanov, II, Min R, Victora GD, Shen Y, Du 

J, Rubtsov YP, Rudensky AY, Ziegler SF, Littman DR. Tgf-beta-induced foxp3 

inhibits t(h)17 cell differentiation by antagonizing rorgammat function. Nature 

2008;453:236-240. 

114. Li MO, Wan YY, Flavell RA. T cell-produced transforming growth factor-

beta1 controls t cell tolerance and regulates th1- and th17-cell differentiation. 

Immunity 2007;26:579-591. 

115. Korn T, Bettelli E, Gao W, Awasthi A, Jager A, Strom TB, Oukka M, 

Kuchroo VK. Il-21 initiates an alternative pathway to induce proinflammatory 

t(h)17 cells. Nature 2007;448:484-487. 

116. Nurieva R, Yang XO, Martinez G, Zhang Y, Panopoulos AD, Ma L, 

Schluns K, Tian Q, Watowich SS, Jetten AM, Dong C. Essential autocrine 

regulation by il-21 in the generation of inflammatory t cells. Nature 

2007;448:480-483. 

117. Wei L, Laurence A, Elias KM, O'Shea JJ. Il-21 is produced by th17 cells 

and drives il-17 production in a stat3-dependent manner. The Journal of 

biological chemistry 2007;282:34605-34610. 



� 47

118. Mangan PR, Harrington LE, O'Quinn DB, Helms WS, Bullard DC, Elson 

CO, Hatton RD, Wahl SM, Schoeb TR, Weaver CT. Transforming growth factor-

beta induces development of the t(h)17 lineage. Nature 2006;441:231-234. 

119. Veldhoen M, Hocking RJ, Flavell RA, Stockinger B. Signals mediated by 

transforming growth factor-beta initiate autoimmune encephalomyelitis, but 

chronic inflammation is needed to sustain disease. Nature immunology 

2006;7:1151-1156. 

120. McGeachy MJ, Bak-Jensen KS, Chen Y, Tato CM, Blumenschein W, 

McClanahan T, Cua DJ. Tgf-beta and il-6 drive the production of il-17 and il-10 

by t cells and restrain t(h)-17 cell-mediated pathology. Nature immunology 

2007;8:1390-1397. 

121. Cho YG, Cho ML, Min SY, Kim HY. Type ii collagen autoimmunity in a 

mouse model of human rheumatoid arthritis. Autoimmunity reviews 2007;7:65-

70. 

122. Aggarwal S, Ghilardi N, Xie MH, de Sauvage FJ, Gurney AL. Interleukin-

23 promotes a distinct cd4 t cell activation state characterized by the production 

of interleukin-17. The Journal of biological chemistry 2003;278:1910-1914. 

123. Murphy CA, Langrish CL, Chen Y, Blumenschein W, McClanahan T, 

Kastelein RA, Sedgwick JD, Cua DJ. Divergent pro- and antiinflammatory roles 

for il-23 and il-12 in joint autoimmune inflammation. The Journal of experimental 

medicine 2003;198:1951-1957. 

124. Molet S, Hamid Q, Davoine F, Nutku E, Taha R, Page N, Olivenstein R, 

Elias J, Chakir J. Il-17 is increased in asthmatic airways and induces human 

bronchial fibroblasts to produce cytokines. The Journal of allergy and clinical 

immunology 2001;108:430-438. 



� 48

125. Liu SJ, Tsai JP, Shen CR, Sher YP, Hsieh CL, Yeh YC, Chou AH, Chang 

SR, Hsiao KN, Yu FW, Chen HW. Induction of a distinct cd8 tnc17 subset by 

transforming growth factor-beta and interleukin-6. Journal of leukocyte biology 

2007;82:354-360. 

126. Starnes T, Robertson MJ, Sledge G, Kelich S, Nakshatri H, Broxmeyer 

HE, Hromas R. Cutting edge: Il-17f, a novel cytokine selectively expressed in 

activated t cells and monocytes, regulates angiogenesis and endothelial cell 

cytokine production. Journal of immunology 2001;167:4137-4140. 

127. Kolls JK, Linden A. Interleukin-17 family members and inflammation. 

Immunity 2004;21:467-476. 

128. Park H, Li Z, Yang XO, Chang SH, Nurieva R, Wang YH, Wang Y, Hood 

L, Zhu Z, Tian Q, Dong C. A distinct lineage of cd4 t cells regulates tissue 

inflammation by producing interleukin 17. Nature immunology 2005;6:1133-

1141. 

129. Yao Z, Fanslow WC, Seldin MF, Rousseau AM, Painter SL, Comeau MR, 

Cohen JI, Spriggs MK. Herpesvirus saimiri encodes a new cytokine, il-17, which 

binds to a novel cytokine receptor. Journal of immunology 2011;187:4392-4402. 

130. Hymowitz SG, Filvaroff EH, Yin JP, Lee J, Cai L, Risser P, Maruoka M, 

Mao W, Foster J, Kelley RF, Pan G, Gurney AL, de Vos AM, Starovasnik MA. Il-

17s adopt a cystine knot fold: Structure and activity of a novel cytokine, il-17f, 

and implications for receptor binding. The EMBO journal 2001;20:5332-5341. 

131. Moseley TA, Haudenschild DR, Rose L, Reddi AH. Interleukin-17 family 

and il-17 receptors. Cytokine & growth factor reviews 2003;14:155-174. 

132. Hoover DM, Boulegue C, Yang D, Oppenheim JJ, Tucker K, Lu W, 

Lubkowski J. The structure of human macrophage inflammatory protein-3alpha 



� 49

/ccl20. Linking antimicrobial and cc chemokine receptor-6-binding activities with 

human beta-defensins. The Journal of biological chemistry 2002;277:37647-

37654. 

133. Kuestner RE, Taft DW, Haran A, Brandt CS, Brender T, Lum K, Harder B, 

Okada S, Ostrander CD, Kreindler JL, Aujla SJ, Reardon B, Moore M, Shea P, 

Schreckhise R, Bukowski TR, Presnell S, Guerra-Lewis P, Parrish-Novak J, 

Ellsworth JL, Jaspers S, Lewis KE, Appleby M, Kolls JK, Rixon M, West JW, 

Gao Z, Levin SD. Identification of the il-17 receptor related molecule il-17rc as 

the receptor for il-17f. Journal of immunology 2007;179:5462-5473. 

134. Toy D, Kugler D, Wolfson M, Vanden Bos T, Gurgel J, Derry J, Tocker J, 

Peschon J. Cutting edge: Interleukin 17 signals through a heteromeric receptor 

complex. Journal of immunology 2006;177:36-39. 

135. Gratchev A, Kzhyshkowska J, Duperrier K, Utikal J, Velten FW, Goerdt S. 

The receptor for interleukin-17e is induced by th2 cytokines in antigen-

presenting cells. Scandinavian journal of immunology 2004;60:233-237. 

136. Lee J, Ho WH, Maruoka M, Corpuz RT, Baldwin DT, Foster JS, Goddard 

AD, Yansura DG, Vandlen RL, Wood WI, Gurney AL. Il-17e, a novel 

proinflammatory ligand for the il-17 receptor homolog il-17rh1. The Journal of 

biological chemistry 2001;276:1660-1664. 

137. Rickel EA, Siegel LA, Yoon BR, Rottman JB, Kugler DG, Swart DA, 

Anders PM, Tocker JE, Comeau MR, Budelsky AL. Identification of functional 

roles for both il-17rb and il-17ra in mediating il-25-induced activities. Journal of 

immunology 2008;181:4299-4310. 

138. Kleinschek MA, Owyang AM, Joyce-Shaikh B, Langrish CL, Chen Y, 

Gorman DM, Blumenschein WM, McClanahan T, Brombacher F, Hurst SD, 



� 50

Kastelein RA, Cua DJ. Il-25 regulates th17 function in autoimmune 

inflammation. The Journal of experimental medicine 2007;204:161-170. 

139. Kotsianidis I, Nakou E, Bouchliou I, Tzouvelekis A, Spanoudakis E, 

Steiropoulos P, Sotiriou I, Aidinis V, Margaritis D, Tsatalas C, Bouros D. Global 

impairment of cd4+cd25+foxp3+ regulatory t cells in idiopathic pulmonary 

fibrosis. American journal of respiratory and critical care medicine 

2009;179:1121-1130. 

140. Chiaramonte MG, Donaldson DD, Cheever AW, Wynn TA. An il-13 

inhibitor blocks the development of hepatic fibrosis during a t-helper type 2-

dominated inflammatory response. The Journal of clinical investigation 

1999;104:777-785. 

141. Reiman RM, Thompson RW, Feng CG, Hari D, Knight R, Cheever AW, 

Rosenberg HF, Wynn TA. Interleukin-5 (il-5) augments the progression of liver 

fibrosis by regulating il-13 activity. Infection and immunity 2006;74:1471-1479. 

142. Webb DC, Mahalingam S, Cai Y, Matthaei KI, Donaldson DD, Foster PS. 

Antigen-specific production of interleukin (il)-13 and il-5 cooperate to mediate il-

4ralpha-independent airway hyperreactivity. European journal of immunology 

2003;33:3377-3385. 

143. Blease K, Schuh JM, Jakubzick C, Lukacs NW, Kunkel SL, Joshi BH, Puri 

RK, Kaplan MH, Hogaboam CM. Stat6-deficient mice develop airway 

hyperresponsiveness and peribronchial fibrosis during chronic fungal asthma. 

The American journal of pathology 2002;160:481-490. 

144. Fichtner-Feigl S, Strober W, Kawakami K, Puri RK, Kitani A. Il-13 

signaling through the il-13alpha2 receptor is involved in induction of tgf-beta1 

production and fibrosis. Nature medicine 2006;12:99-106 



� 51

.  

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

3. HIPÓTESE DE TRABALHO 



� 52

Levantamos a hipótese que os modelos experimentais de doença 

pulmonar fibrosante induzidos por bleomicina e paraquat causam diferentes 

mecanismos de injúria do interstício pulmonar. Estes mecanismos perfazem 

vias fisiopatológicas, o mais próximo da fibrose pulmonar humana, que 

resultam em estabelecer o processo de remodelamento pulmonar. As vias 

devem envolver, após micro-injúria, a participação do colágeno V, como 

neoantígeno e/ou imunoestimulante, que ativam e/ou intensificam a resposta 

inflamatória conduzidas por células Th17, levando à fibrose e/ou sua 

perpetuação. 

 

 

 

 

 

 

 

 

 

 

 

 



� 53

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

4. OBJETIVO 



� 54

Analisar as vias fisiopatológicas de remodelamento parenquimatoso na 

fase tardia de modelos experimentais clássicos de fibrose pulmonar visando 

caracterizar o papel do Colágeno V e da IL-17 na sua patogênese.  

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 



� 55

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

5. RESUMO



� 56

A fibrose pulmonar é a base patológica de uma variedade de doenças 

crônicas incuráveis. A IL-17A, uma glicoproteína secretada de células Th17, é 

uma citocina pró-fibrótica relacionada recentemente à síntese de colágeno V e 

fibrose pulmonar. O remodelamento parenquimatoso pulmonar da matriz 

extracelular pelo colágeno I e V, apoptose e resposta Th17 foi estudado em 

camundongos Balb/c, C57/B6J selvagens e com knockout para o receptor A da 

IL-17; para determinar as vias fisiopatológicas que prolongam a fase tardia do 

processo fibrótico induzido por bleomicina e paraquat. Microscopia eletrônica, 

imunofluorescência, imunohistoquímica, detecção in situ da apoptose, 

morfometria, reconstrução tridimensional e reação em cadeia da polimerase em 

tempo real foram usados para avaliar a quantidade, estrutura e cadeias 

moleculares dos tipos de colágenos, apoptose e células imunes.  Verificamos 

um aumento da síntese e secreção do colágeno V que promove a perpetuação 

da fibrose pulmonar de maneira IL-17A dependente. Além disso, observou-se 

que marcadores críticos da resposta Th17 como IL17, STAT3, TGF-�, IL-6, IL-

21, IL-23 e células T CD4+ foram significantemente aumentados em cepas 

susceptíveis a fibrose pulmonar e intensificadas na ausência do receptor A da 

IL-17. O aumento de marcadores Th17 resulta em um aumento de células T 

CD4+ através de uma resposta imune que efetivamente bloqueia a degradação 

do colágeno V, o qual contribui para o bloqueio da apoptose.  Nosso estudo 

indica que o colágeno V participa da perpetuação da fibrose pulmonar por 

mecanismos IL-17 dependente e independentes, indicando o potencial alvo 

terapêutico do colágeno V e das vias de sinalização da resposta IL-17 no 

tratamento das doenças fibroproliferativas pulmonares. 

Paravras-chaves: Fibrose Pulmonar Exprimental, Colágeno V, IL-17, 

Microscopia eletrônica, Reconstrução 3D, Imunohistoquímica, Biologia 

Molecular, Imunofluorescência 



� 57

6. ABSTRACT 



� 58

 

Pulmonary fibrosis is the pathologic basis for a variety of incurable 

human chronic lung diseases. IL-17A, a glycoprotein secreted from IL-17–

producing cells, has recently been shown to be a profibrotic cytokine involved in 

type V collagen synthesis and pulmonary fibrosis. Remodeling of the 

extracellular matrix by collagen I and V,  cell death and Th-17 immune response 

were evaluated in Balb/c,  wild and  IL-17 receptor A knockout C57/B6J mice, to 

determine the pathways that prolong the late phase of the fibrotic process 

induced by bleomycin and paraquat. Electron microscopy, immunofluorescence, 

immunohistochemistry, in situ detection of apoptosis, morphometry, 

tridimensional reconstruction and a real-time PCR were used to evaluate the 

amount, structure and molecular chains of collagen types, apoptosis and 

immune cells. We verified increased synthesis and secretion of type V collagen 

that promoted the maintenance of pulmonary fibrosis in a IL-17A dependent 

manner. However, we observed that the critical Th17 markers, IL-17, STAT3, 

TGF-�, IL-6, IL-21, IL-23 and CD4+ T cells, were significantly increased in the 

fibrosis-susceptible strain and intensified in the absence of IL-17 receptor A. 

Increased Th17 markers resulted in an increase in CD4+ T cells in fibrotic lung 

tissue toward an immune response that effectively blocked degradation of 

collagen V, which contributes to block apoptosis. Our studies indicate that 

collagen V participates in the maintenance of pulmonary fibrosis in both Th-17 –

dependent and -independent manners and that collagen V and the components 

of the Th-17 signaling pathway are potential therapeutic targets for the 

treatment of fibroproliferative lung diseases.  

Keywords: Experimental pulmonary fibrosis, collagen V, IL-17, electron 

microscopy, 3D-reconstruction, immunohistochemistry, molecular biology, 

immunofluorescence. 



� 59

 

7. ARTIGO CIENTÍFICO 



� 60

Collagen V maintains Experimental Pulmonary Fibrosis in 

IL17–dependent and -independent pathways 

Alexandre Todorovic FABRO1; Igor Otavio MINATEL1, Pedro Henrique Ramos 

Quintino da SILVA2, William Sanches ZOCOLARO2, Mozar Suzigan de 

ALMEIDA2, Erika da Costa PRANDO3, Claudia Aparecida RAINHO3, Walcy 

Rosolia TEODORO2, Ana Paula Pereira VELOSA2, Edwin Roger PARRA-

CUENTAS2, Helmut H POPPER4, Vera Luiza CAPELOZZI�2 
1 Pathology Department, Botucatu Medical School, São Paulo State University 

(UNESP), Brazil;  
2  Laboratory of Histomorphometry and Lung Genomics, Faculty of Medicine, 

University of Sao Paulo (USP), Brazil;  
3 Genetic Department, Biosciences Institute, São Paulo State University (UNESP), 

Brazil; 
* Institute of Pathology, Graz University; Austria 
 

Financial support:

This study was supported by the following Brazilian agencies: the National 

Council for Scientific and Technological Development [CNPq UNIVERSAL 

471939/2010-2, 140064/2012-5]; the São Paulo Research Foundation 

[FAPESP: 09/50905-4, 2010/06065-9, 2010/05266-0,2010/05704-8]; and the 

Coordination for the Improvement of Higher Level Personnel [Capes: 2329-10-

7]; Silver Sponsorship for Oral Presentation at the 2012 Vienna European 

Respiratory Congress 

Reprint requests and corresponding author:

Prof Dr Vera Luiza Capelozzi, Departamento de Patologia 

Faculdade de Medicina da Universidade de São Paulo 

Av. Dr. Arnaldo 455, sala 1143, ZIP CODE 01296-903, São Paulo, SP, Brazil 

Phone: 55-11 3061-7427; FAX – 55-11 3064-2744 

E-mail: vcapelozzi@lim05.fm.usp.br
������������������������������������������������������������
*�Apresentado�de�acordo�com�as�normas�para�submissão�no�periódico�Experimental�Molecular�Pathology.�



� 61

Abstract

 

Pulmonary fibrosis is the pathologic basis for a variety of incurable 

human chronic lung diseases. IL-17A, a glycoprotein secreted from IL-17–

producing cells, has recently been shown to be a profibrotic cytokine involved in 

type V collagen synthesis and pulmonary fibrosis. Remodeling of the 

extracellular matrix by collagen I and V,  cell death and Th-17 immune response 

were evaluated in BALB/c,  Wild C57 and  IL-17 receptor A knockout C57 mice, 

to determine the pathways that prolong the late phase of the fibrotic process 

induced by bleomycin and paraquat. Electron microscopy, immunofluorescence, 

immunohistochemistry, in situ detection of apoptosis, morphometry, 

tridimensional reconstruction and a real-time PCR were used to evaluate the 

amount, structure and molecular chains of collagen types, apoptosis and 

immune cells. We verified increased synthesis and secretion of type V collagen 

that promoted the maintenance of pulmonary fibrosis in a IL-17A dependent 

manner. However, we observed that the critical Th17 markers, IL-17, STAT3, 

TGF-�, IL-6, IL-21, IL-23 and CD4+ T cells, were significantly increased in the 

fibrosis-susceptible strain and intensified in the absence of IL-17 receptor A. 

Increased Th17 markers resulted in an increase in CD4+ T cells in fibrotic lung 

tissue toward an immune response that effectively blocked degradation of 

collagen V, which contributes to block apoptosis. Our studies indicate that 

collagen V participates in the maintenance of pulmonary fibrosis in both Th-17 –

dependent and -independent manners and that collagen V and the components 

of the Th-17 signaling pathway are potential therapeutic targets for the 

treatment of fibroproliferative lung diseases.  



� 62

Keywords: Experimental pulmonary fibrosis, collagen V, IL-17, electron 

microscopy, 3D-reconstruction, immunohistochemistry, molecular biology, 

immunofluorescence. 

 

 

Introduction

Pulmonary fibrosis can be caused by a large number of lung diseases. 

The most common interstitial lung disease of unknown etiology is Idiopathic

Pulmonary Fibrosis (IPF), which has a dismal prognosis and, at present, no 

effective treatment option is available (American Thoracic and European 

Respiratory, 2002). IPF proliferation and activation of fibroblasts to 

myofibroblasts causes excessive and disordered deposition of matrix proteins, 

resulting in severe architectural changes of the alveolar walls (Baptista et al., 

2006; Kuhn and McDonald, 1991). These lead  the loss of functional alveolar 

capillary units and respiratory failure (Fukuda et al., 1995). Despite significant 

advances concerning the cellular and molecular mechanisms of pulmonary 

fibrosis, its etiopathogenesis remains unclear (Fernandez and Eickelberg, 

2012). 

Recently, it has been suggested that type V collagen plays an important 

role in remodeling of several fibrosing lung diseases, including pulmonary 

sclerosis (Parra et al., 2009; Parra et al., 2010), bronchiolitis obliterans 

syndrome (Braun et al., 2009; Garippo et al., 2007), usual interstitial pneumonia 

(Parra et al., 2006) and the microenvironment� of lung cancer (Souza et al., 

2010). Collagen V is abundant in the skin, placenta and lungs and is essential 

for tissue elasticity and compliance (Linsenmayer et al., 1993; O'Sullivan et al., 



� 63

2003). It is a minor collagen and a cryptogenic antigen that, together with 

collagens I and III, constitutes the heterotypic fibrils and is not normally 

recognized by the immune system in normal collagen fibril structure (Birk et al., 

1990; Linsenmayer et al., 1993). The injury and repair process can cause 

exposure of collagen V, which has been linked to the Th17 response, 

contributing to the pathogeneses of fibrosing lung diseases (Braun et al., 2009; 

Burlingham et al., 2007; Mi et al., 2011; Nakashima et al., 2012). The Th17 

pattern is characterized� by CD4+T cells producing IL-17, a potent 

proinflammatory cytokine (Bettelli et al., 2007; Park et al., 2005). Several 

cytokines, such as TGF-�, IL-6, IL-21 and IL-23 participate in the differentiation,  

amplification and stabilization of Th17 cells, respectively (Bettelli et al., 2008). 

Many different approaches to modeling pulmonary fibrosis have been 

employed by investigators providing research tools for the study of new 

pathways and to test hypotheses.  Among these, the most commonly used 

include exposure to bleomycin (Gauldie and Kolb, 2008; Moore and Hogaboam, 

2008) and paraquat (Honore et al., 1994; Ishida et al., 2006; Satomi et al., 

2007). However, a major pitfall with these methods is that the murine lung, 

particularly Balb/c and C57, are able to recover quickly from this single injury 

and the disease findings are reversible to near normal lung in many studies by 

six weeks (Chung et al., 2003). However, despite these limitations, the 

bleomycin and paraquat models have undoubtedly been extremely important in 

deciphering which mechanisms prolong or recover pulmonary fibrosis in Balb/c 

and C57 mouse strains. Thus the mechanisms that prolong the fibrotic process 

in the late phase in certain strains may participate in the progression of 

pulmonary fibrosis. Using  bleomycin and paraquat models of pulmonary 



� 64

fibrosis, our group investigated whether IL-17A directly regulates type V 

collagen synthesis via immune mechanisms in BALB/c,  Wild C57 and  IL-17 

receptor A knockout C57 mice. �We observed increased synthesis and secretion 

of type V collagen that promoted the maintenance of pulmonary fibrosis in a IL-

17A dependent manner. We also verified that increased IL-17 resulted in an 

increase in CD4+ T cells in fibrotic lung tissue toward an immune response that 

effectively blocked apoptosis and degradation of collagen. Our studies indicate 

that collagen V participates in the maintenance of pulmonary fibrosis in both 

Th17-dependent and -independent manners and that collagen V and the 

components of the IL-17A signaling pathway are potential therapeutic targets 

for the treatment of fibroproliferative lung diseases. 

 

Material and Methods 

 

Experimental Design  

Male mice, aged 4 to 6 weeks-old, were divided into four groups and their 

respective controls: i) Paraquat-induced BALB/c mice (PQ Balb; n=15, 

control=10); ii) Bleomycin-induced BALB/c mice (BLM Balb; n=15, control=10); 

iii) Bleomycin-induced wild C57 Black/6J mice (C57; n=10, control=5); iv) 

Bleomycin-induced IL17 receptor A knockout C57 Black/6J mice (IL17-KO C57; 

n=8, control=5) (kindly donated by Dr. João Santana da Silva, USP, Ribeirão 

Preto, Brazil). The mice were housed under a constant 12 h light/ dark cycle in 

a temperature controlled room, with ad libitum access to food and water, in 

accordance with the Ethical Guidelines for Animal Experiments of the National 

Institutes of Health. All procedures were reviewed and approved by the 



� 65

institutional review board, the Research Ethics Committee of Botucatu Medical 

School, São Paulo State University, under protocol no. 721/09. The bleomycin-

induced groups were administered a single intratracheal instillation of 2 U/kg of 

bleomycin. A single dose of Paraquat (15mg/Kg) were injected�intraperitoneally 

in PQ Balb group. After 21 days, the mice were sedated, anaesthetized 

(intraperitoneal 10mg/kg ketamine, Park-Davis and 0.3mg/Kg xylazine, 

Rompum, Bayer, Brazil), exsanguinated via the abdominal aorta to minimize 

blood spillage into the pulmonary cavity and then rinsed free of blood with saline 

solution. The left lung was quickly removed under sterile conditions to perform 

primary cell cultures from tissue explants. The right lung was inflated in situ 

through the right bronchus at a pressure of 15 mmH2O, to calculate the mouse 

tidal volume, and fixed with 10 ml/kg (0.2 ml) of buffered formalin for 6 h. The 

lungs were then stored in 70% ethanol for 24 h at ambient temperature and 

embedded in paraffin. Histological sections (5 μm thick) were obtained and then 

stained with hematoxylin-eosin and submitted for immunohistochemistry and 

immunofluorescent.  

Histochemistry, immunohistochemistry, immunofluorescence and in situ 

detection of apoptosis

Histochemistry was performed to characterize total collagen fibers in 

peribronchiolar and peripheral pulmonary areas using Picro Sirius Red Stain. 

Quantification was performed by image analysis following the standard protocol 

of our laboratory, as described in detail by Silva et al (Silva et al., 2012). The 

images were processed using the program Image Pro-Plus, version 7.0 (Media 

Cybernetics Inc., Bethesda, MD, USA). For each tissue specimen, a range of 8-



� 66

10 slides were analyzed at 400x magnification. The final results were expressed 

as a percentage of the stained area per total peribronchiolar or total septal area. 

Immunohistochemical analysis was used to evaluate IL-17-related 

markers and immune cells in peripheral� septal� parenchymal, as previously 

described by Garippo et al (Garippo et al., 2006). Tissue microarray was 

constructed from all paraffin blocks with 3 core tissue from each sample. We 

used the following antibodies: CD20, B-Cell (Clone L26, Dako Corporation 

Carpinteria, USA, 1:600); CD3 (Leu-4, T3, 1:600), CD4 (CD45RO, clone OPD4, 

1:400); CD8 (Clone C8/144B, 1:100); IL-17 SC7927, 1:500); STAT3 (SC482; 

1:400); IL-6; TGFbeta (SC146, 1:200); IL-21 (SC17647, 1:100) ; IL-23 

(SC21079, 1:100) ;; FGF-1 (SC1884, 1:500; IL-13 (SC1776, 1:400); TNF-alfa 

(SC1348, 1:200),  and CD83 (SC14592, 1:600). The markers were quantified by 

a conventional stereological method, as recommended�by ATS/ERS standards 

for quantitative assessment of lung structure (Hsia et al., 2010). 

Immunofluorescence was used to discriminate collagen 

types I, III and V in septal interstitium and image analysis was used to quantify 

these using 3 �m paraffin-embedded sections, as previously described by Parra 

et al�(Parra et al., 2010). 

In situ hybridization was used to identify apoptosis in lung parenchyma 

via TUNEL (+) nuclear expression by deoxynucleotidyl transferase (TdT) end 

labeling (TUNEL) (Boehringer Mannheim, Mannheim, Germany).   

Primary cell cultures from tissue explants and RT�PCR�of collagen

Following the quickly removal of the left lung from the mouse using a 

sterile technique, it� was placed� in a Petri dish and cut into small pieces (less 



� 67

than 0.5 mm). Working in a sterile hood, DMEM/F12 medium containing 10% 

fetal bovine serum with penicillin/streptomycin/amphotericin was added and 

tissue pieces were dispersed along the bottom of the 25cm2 flask. The flasks 

were maintained at 37°C in a cell culture incubator with 5% CO2-95% air. The 

medium was changed every 2 to 3 days until the cells achieved subconfluence 

(i.e., 90% confluent). At this point, the fibroblast cells were trypsinized and 

transferred to two other flasks. For this experiment, the fibroblast cells from 

passage 3 to 4 were used until fusiform-shaped cells were observed. The 

adherent fibroblast cells were trypsinized again and total RNA was isolated 

using Trizol reagent to evaluate the biomolecular profile of collagen types I, III 

and V by real-time polymerase chain reaction (RT-PCR), as previously 

described by Parra et al (Parra et al., 2010). Primer sets were designed based 

on the coding region closer to the 3’ end of the gene using Applied Software: 

ACTB Forward: GGCTCTTTTCCAGCCTTCCT, Reverse: 

GTCTTTACGGATGTCAACGTCACA; Col1A1 Forward: 

GGCCTTGGAGGAAACTTTGC, Reverse: GCACGGAAACTCCAGCTGAT; 

Col3A1 Forward: CCTGGCTCCCCTGGAATCT, Reverse: 

CCATTCCTCCCACTCCAGACT; COL5A1 Forward: 

AGCACCACTGTTACCTCCAA, Reverse: AGGAAGTCCTTTCTCTCCAG. 

Confocal and Electron Microscopy 

Ultrastructural immunohistochemical localization of collagen types was 

performed by Immunogold electron microscopy, with ultrathin mouse lung 

sections fixed in 4% paraformaldehyde and embedded in Lowicryl HM-20 resin, 

following the protocol established by our�laboratory�(Prota et al., 2010). 



� 68

To visualize the distribution of the collagens, providing additional and 

useful morphological data for a clearer understanding of the interaction between 

them,  we performed confocal laser scanning microscopy,  a technique for 

obtaining high-resolution optical images known as optical scanning sectioning, 

which permits three-dimensional reconstructions of topologically complex 

collagen, as our group previously described (Parra et al., 2010; Santana et al., 

2010). 

Heart measurements 

 The heart was dissected and the right left ventricular wall thickness ratio 

was calculated as an index of right ventricular hypertrophy. The largest slice 

was taken using a Canon camera at a height of 15cm. The images were 

analyzed by Image J software using four distributed measurements in the 

ventricular walls. An average ventricle thickness ratio was calculated for each 

case using the measurements from the four distinct positions on the ventricle 

cross section. 

Statistical analysis 

The data were expressed as mean ± standard deviation. All statistical 

procedures were performed using SPSS software v.13.0 (SPSS, Inc., Chicago, 

IL 2004). The data were assessed using the t test and ANOVA with Tukey or 

Dunnett post-hoc tests for multiple comparisons, when normality of the data and 

homogeneity of variances were satisfied. A P value of less than 0.05 was 

considered statistically significant. 

 

 



� 69

Results

Septal fibroblast cells determine resistance or susceptibility to pulmonary 

fibrosis. 

In the late stage of experimental pulmonary fibrosis, resolution of the 

fibrotic process can occur, as observed in the resistant Balb strain. However, 

persistence of the fibrotic process can also occur, as verified in the susceptible 

strain C57.  

To determine the microanatomical compartment responsible for the 

perpetuation of pulmonary fibrosis, we evaluated total collagen, one of the final 

products of the fibroblast cell during the fibrotic process, using the histochemical 

technique Picrosirius and morphometric analysis in Balb and C57 mouse 

tissues. We demonstrated that the total peribronchiolar collagen did not differ 

between the two treated strains (Figure 1). In contrast, a significant increase in 

total collagen was observed in peripheral septal parenchyma of the treated C57 

groups (Figure 1). 

To validate these findings, primary culture of fibroblast cells from control 

and treated mice were established to assess the gene expression of type I 

collagen in vitro. Collagen I, the main structural protein of pulmonary interstitium 

during fibrotic process, was also significantly increased in the C57 groups 

compared with the Balb groups (Figure 2). 

 

 

 



� 70

The expression of collagen I in peripheral lung parenchyma is IL-17- 

independent in the fibrosis-susceptible strain. 

Type I collagen appears to be the principal collagen at later stages in the 

murine models of pulmonary fibrosis and the alveoli-capillary junction is 

widened by the addition of collagen fibers to alveolar-capillary membrane. 

Additionally, pulmonary fibrosis has been associated with the Th17 pattern. 

To test the relation between collagen I and the Th17 pattern in peripheral 

septal parenchyma, we evaluated the expression of collagen I in situ by 

immunofluorescence in C57 and IL17 KO C57 mice. The protein expression in 

the fibrosis-susceptible strain was significantly higher than controls and similar 

to the bleomycin-treated groups (Figure 2). Surprisingly, in the fibrosis-resistant 

strain, the expression of collagen I was lower than in controls. These data 

corroborate our findings with Picrosirius-stained peripheral collagen and 

cultured fibroblasts. 

Collagen V expression is linked to susceptibility to pulmonary fibrosis in 

an IL17-dependent pathway. 

Pulmonary interstitial remodeling resulted in extracellular matrix 

degradation and neoformation with exposure to normally cryptic proteins, 

including collagen V, which has been associated with autoimmunity and the 

Th17 pattern.  

To determine the role of collagen V and IL-17 response in susceptibility 

or resistance in late stage pulmonary fibrosis in situ, we evaluated collagen V 

using immunofluorescence in wild Balb and C57 group and IL-17 knockout 

mice. Surprisingly, we determined a significantly lower expression of collagen V 



� 71

in BLM Balb mice and a stepwise increase in the expression of collagen V 

between the C57, control IL-17 KO C57 and IL-17 KO C57, respectively (Figure 

3). 

To validate our results, we evaluated collagen V by gene expression, 

immunogold labeling electron microscopy and confocal analysis. Collagen V 

gene expression showed downregulation in the Balb group and upregulation in 

IL-17 KO C57 group (Figure 3). Collagen V was located as sparse gold particles 

along the fibrils, predominantly associated with loosely formed aggregates 

distinct from the collagen I fibrils in the IL-17-KO-C57 group (Figure 4). Confocal 

microscopy revealed irregular deposits of collagen V in the basement 

membrane of the alveolar-capillary unit with intermittent distribution in the 

fibrosis-susceptible strain (Figure 5). 

 

The upregulation of Th17-related markers in fibrosis-susceptible strains is 

amplified in the absence of the IL-17 receptor A.

The formation of the IL-17 response is complex, involving multiple critical 

cytokines and other IL-17-related markers, CD4+ T cells and five different IL17-

receptors, one of which is the main receptor mediating the TH17 pattern, 

receptor A. 

To establish the profile of Th17-related markers, we evaluated these in 

situ using an amplified immunohistochemical panel. The critical Th17 markers, 

IL-17, STAT3, TGF-�, IL-6, IL-21, IL-23 and CD4+ T cells, were significantly 

increased in the fibrosis-susceptible strain and intensified in the absence of IL-

17 receptor A (Figures 6 and 7). Similar expression patterns were observed of 

FGF-2 and IL13, both key mediators of tissue fibrosis (Figure 7). However, 



� 72

TNF-�, an initial inflammatory mediator of pulmonary fibrosis, showed no 

significant differences between the groups, corroborating our findings 

concerning the late stage of experimental pulmonary fibrosis (Figure 8).  

 

Resistance to late stage pulmonary fibrosis is drug-independent. 

Animal models of pulmonary fibrosis can be the result of drug-induced 

toxicity. Depending on the drug, its toxicity can activate distinct pathways to 

establish the characteristic fibrosis of each model. Paraquat exposure leads to 

the production of reactive oxygen species (ROS) through a process of redox 

cycling and bleomycin forms a complex with ferrous ions and molecular oxygen 

to produce single- and double-strand breaks in DNA (scission). 

To determine the effect of bleomycin and paraquat toxicity in the late 

stage of fibrotic process, we evaluated the protein expression of total collagen, 

Th17-related markers and collagen I and V in Balb mice. There was no 

difference in peribronchiolar and peripheral septal fibrosis were determined 

between the groups treated with bleomycin and paraquat using picrosirius 

staining and morphometric analysis (Figure 1). No difference in collagen I and V 

protein expression was determined between the groups treated with bleomycin 

and paraquat by RT-PCR and immunofluorescence (morphometric analysis) 

(Figures 2 and 3). However, in both treated groups, a reduction collagen I and V 

in relation to their own controls was observed, together with an increase in 

CD8+ T cells (Figure 8). 



� 73

Reduction in autophagy-associated cell death in the late stage in the 

fibrosis-susceptible strain contributes to decreased collagen degradation 

in the alveolar epithelial cells and vascular remodeling  

A complicated interaction between epithelial cells, fibroblast activation 

with extracellular matrix deposition in the form of collagen V, IL-17 response 

and vascular cells seem to be regulated by a wide variety of angiogenesis 

promoters, growth factors and apoptosis, resulting in the induction of vascular 

remodeling, pulmonary hypertension and right ventricular hypertrophy.  

To determine the degree of chronic pulmonary hypertension and the 

pulmonary apoptotic index, we evaluated the right left ventricular wall thickness 

ratio and performed the TUNEL assay with in situ hibridization. A significant 

reduction in apoptosis was verified in the fibrosis-susceptible strain and the 

paraquat-treated group. In contrast, an increase in the right left ventricular wall 

thickness ratio only occurred in the IL-17 KO C57 group compared with the BLM 

Balb group, while the IL-17 KO C57 group showed a tendency� toward� increase�

compared with�its control (Figure 9).

Discussion 

 

Experimental pulmonary fibrosis models have been developed to study 

the evolution of fibrotic responses that more closely resemble idiopathic 

pulmonary fibrosis (Gauldie and Kolb, 2008); however, they have failed to 

specifically mimic its irreversible and progressive condition (Moeller et al., 

2008). Different strains show distinct spatiotemporal patterns of fibrotic 

phenotype in late stage disease (Moeller et al., 2008), which have been 



� 74

implicated in the genetic background (Barth et al., 2002; Kaminski et al., 2000), 

in cytokines patterns (Phan and Kunkel, 1992) and in proteases/anti-proteases 

and specific extracellular matrix compositions (Kolb et al., 2002).  Although 

these pathophysiological events that permit the perpetuation of pulmonary 

fibrosis in susceptible strains have not been completely elucidated, they activate 

the myofibroblast, the major source of the extracellular matrix and collagen I, 

which causes�remodeling (Phan, 2002).  

In this study, bleomycin and paraquat models were used to investigate 

whether IL-17A directly regulates type V collagen synthesis via immune 

mechanisms in fibrosis-resistant Balb/c mice, fibrosis-susceptible C57 and  IL-

17 receptor A knockout C57 mice. In our study, we observed no difference in 

peribronchiolar collagen between fibrosis-resistant and fibrosis-susceptible 

strains in the late stage; rather the difference between these strains, previously 

reported in the literature, was due to deposition of peripheral septal collagen, 

indicating that the microanatomical location of the myofibroblast plays a critical 

role in parenchymal remodeling. The activation of myofibroblast can be 

modulated by IL-17 response (Hata et al., 2002) and  a critical role for IL-17 in 

pulmonary fibrosis has been suggested by increased IL-17 in the 

bronchoalveolar lavage fluid of patients with IPF and in bleomycin-induced 

pulmonary fibrosis (Gasse et al., 2011; Mi et al., 2011; Wilson et al., 2010). We 

tested the response of myofibroblasts to IL-17 signaling using IL-17 receptor A 

knockout mice. Surprisingly, no differences in deposition of total and type I 

collagen in situ in the peripheral septal parenchyma were verified between 

IL17RA knockout and wild fibrosis-susceptible strains, despite the increased 

protein expression of IL-17 and IL-17-related markers in peripheral septal 



� 75

parenchyma. These data demonstrate that the absence of IL-17 receptor A 

promotes a response in which IL-17 is required to maintain and perpetuate the 

same pulmonary fibrosis in the fibrosis-susceptible strain. 

We were able to demonstrate that the expression of collagen V in septal 

peripheral parenchyma was increased in the fibrosis-susceptible strain, with 

irregular collagen V deposits in the basement membrane, which were 

decreased in the fibrosis-resistant strain. These findings suggest that increased 

synthesis and secretion of type V collagen promotes the maintenance of 

pulmonary fibrosis in a IL-17A-dependent manner. However, we determined 

that the critical Th17 markers, IL-17, STAT3, TGF-�, IL-6, IL-21, IL-23 and 

CD4+ T cells, were significantly increased in the fibrosis-susceptible strain and 

intensified in the absence of IL-17 receptor A. Increased Th17 markers resulted 

in a