Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 109(3): 379-383, May 2014 379 online | memorias.ioc.fiocruz.br Identification of the food source of arthropods allows a better understanding of the vector dynamics and trans- mission routes of diseases carried by vectors. It may be the best way to clarify which species are incriminated as zoonosis reservoirs and could therefore indicate better control strategies (Ribeiro 1999). Traditionally, analysis of the dietary content of hae- matophagous arthropods has been carried out using immunological techniques (Mukabana et al. 2002b). However, serological methods present two limitations: (i) it is impossible to distinguish species that are phylo- genetically close (Silva et al. 2001) and (ii) the analysis is restricted to one group of vertebrates because of the use of species-specific antiserum (Dias et al. 2003, Marassá et al. 2006). Studies have identified a well-preserved DNA sequence in the cytochrome B (cytb) gene, which is present in mitochondrial DNA and codes for an elec- tron-transporting protein (Meece et al. 2005). This DNA sequence exhibits few intraspecies variations, but suffi- cient interspecies variations, thereby increasing its spec- ificity. Thus, a large number of hosts may be analysed using universal primers and phylogenetically close spe- cies may be distinguished using a molecular test based on the cytb gene (Boakye et al. 1999, Chow-Shaffer et al. 2000, Lee et al. 2002, Meece et al. 2005, Steuber et al. 2005, Muturi et al. 2011, Garlapati et al. 2012, Tiwanan- thagorn et al. 2012, Pettersson et al. 2013). The aim of the present study was to provide theo- retical validation for using PCR-RFLP of the cytb gene as a technique to discriminate the blood meal source of Lutzomyia longipalpis. The restriction fragment profiles of some vertebrate species identified as possible sandfly food sources were analysed. It was found that the spe- cies could be differentiated according to the sizes of the restriction fragments. The mitochondrial cytb gene fragments of the 11 species used in this study (Homo sapiens - HOSA, Rattus norvegi- cus - RANO, Didelphis marsupialis - DIMA, Canis famili- aris - CAFA, Felis catus - FECA, Sus domesticus - SUDO, Bos taurus - BOTA, Gallus gallus - GAGA, Equus cabal- lus - EQCA, Cerdocyon thous - CETH and Pseudalopex doi: 10.1590/0074-0276130405 + Corresponding author: vyrsoares@gmail.com Received 16 August 2013 Accepted 25 February 2014 Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene Vítor Yamashiro Rocha Soares1/+, Jailthon Carlos da Silva1, Kleverton Ribeiro da Silva2, Maria do Socorro Pires e Cruz2, Marcos Pérsio Dantas Santos3, Paulo Eduardo Martins Ribolla4, Diego Peres Alonso4, Luiz Felipe Leomil Coelho5, Dorcas Lamounier Costa1, Carlos Henrique Nery Costa1 1Laboratório de Pesquisas em Leishmanioses, Departamento de Medicina Comunitária, Instituto de Doenças Tropicais Natan Portela 2Laboratório de Sanidade Animal, Departamento de Morfofisiologia Veterinária, Universidade Federal do Piauí, Teresina, PI, Brasil 3Instituto de Ciências Biológicas, Universidade Federal do Pará, Belém, PA, Brasil 4Departamento de Parasitologia, Instituto de Biociências de Botucatu, Universidade Estadual Paulista, Botucatu, SP, Brasil 5Instituto de Ciências Biomédicas, Universidade Federal de Alfenas, Alfenas, MG, Brasil An analysis of the dietary content of haematophagous insects can provide important information about the trans- mission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA. Key words: blood meal analysis - cytochrome B - PCR-RFLP Blood meal source of Lu. longipalpis • Vítor Yamashiro Rocha Soares et al.380 vetulus - PSVE) were amplified in silico using the primers BM1 (5’CCCCTCAGAATGATATTTGTCCTCA3’) and BM2 (5’CCATCCAACATCTCAGCATGATGAAA3’) and Basic Local Alignment Search Tool software, which is available from the National Center for Biotechnology Information (GenBank). The sequence of the expected product (358 bp) was species-specific and the Aci I, Alu I, Hae III and Rsa I restriction sites were identified us- ing Restriction Mapper software. The restriction profiles of the fox species P. vetulus and C. thous were the only two that were not analysed because it was not possible to identify the 358 bp cytb fragment in these species in GenBank. Each species had a restriction fragment profile that was distinct from the others. Thus, these profiles rep- resented a unique “fingerprint”, which could be an impor- tant method for distinguishing between each species. Biological samples (peripheral blood or cellular tis- sue) of the vertebrate species were collected and DNA was extracted. The mitochondrial cytb gene fragment (358 bp) was amplified using the BM1 and BM2 primers following the protocol of Meece et al. (2005) (Fig. 1). However, PSVE presented a unique problem: the poly- merase chain reaction (PCR) amplified not only the 358 bp fragment, but also a fragment of approximately 615 bp. This fox species is rare and threatened, lives mainly in the central part of Brazil and was excluded from the study (Costa & Courtenay 2003). However, the presence of these two bands allowed for the differentiation of PSVE from the other animals. The amplified fragments were sequenced to deter- mine the degree of conservation of the cytb gene. Com- paring the sequenced loco-regional samples with the deposited GenBank sequences, most species presented few mismatches, with no compromised restriction sites and with degrees of similarity greater than 98% (Table I). There were no changes in the restriction sites of CAFA, HOSA, GAGA, RANO, SUDO or BOTA. How- ever, EQCA and FECA gained Aci I and Rsa I restriction sites, respectively and DIMA lost two Alu I restriction sites (Table I, Supplementary data). Because the number of cytb sequences deposited in GenBank is limited, se- quencing of this fragment in loco-regional host species becomes important for analysis using the PCR-restric- tion fragment length polymorphism (RFLP) technique. As cytb sequences continue to be deposited into these genetic databases and as the variations in mtDNA be- come better understood, sequencing of this fragment from loco-regional host species will be needed less fre- quently, thus reducing costs and increasing the applica- bility of the method. TABLE I Identification of the species that were candidates as possible food sources for sandflies Species Common name Access (BLAST/NCBI) Similarity GenBank/Regional (%) Changes in restriction sites Homo sapiens (HOSA) Human AY509658 99 0 Rattus norvegicus (RANO) Rats AB033713 98 0 Didelphis marsupialis (DIMA) Opossum DMU34665 97 -2 Canis familiaris (CAFA) Dog DQ309764 100 0 Felis catus (FECA) Domestic cats AY509646 99 +1 Sus domesticus (SUDO) Pig AY534296 99 0 Bos taurus (BOTA) Cattle AY682380 99 0 Gallus gallus (GAGA) Hens AY509649 100 0 Equus caballus (EQCA) Horse AY819736, AY819737 99 +1 Cerdocyon thous (CETH) Crab-eating fox AF028169 83a Unparsed Pseudalopex vetulus (PSVE) Hoary fox EF106996 - Unparsed a: the sequenced fragment of cytochrome B gene had a 99% affinity with the Canis familiaris from GenBank; BLAST: Basic Local Alignment Search Tool; NCBI: National Center for Biotechnology Information. Fig. 1: electrophoresis with polymerase chain reaction on the DNA extracted from peripheral blood and tissue samples from the verte- brate species amplified using the BM1 and BM2 primers (fragment of mitochondrial cytb ≅ 358 bp). L: DNA Leader 100 bp; NEG: nega- tive control. 381Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 109(3), May 2014 To confirm the in silico analysis, the PCR products were submitted to enzymatic digestion using the Aci I, Alu I, Hae III and Rsa I enzymes. The restriction pro- files of the species studied are shown in Fig. 2 and Table II. In practice, the restriction pattern of Aci I showed the expected fragments (244 bp and 113 bp) for DIMA, FECA and EQCA. Regarding the DNA of HOSA, a 244 bp band was found in addition to the expected fragments (189 bp, 113 bp and 55 bp). The expected restriction pat- tern of GAGA was observed; however, the 49 bp frag- ment could not be visualised because of its small size. The Aci I endonuclease did not cut the DNA of CAFA, BOTA, SUDO, RANO or CETH. When the DNA samples were digested with Alu I enzymes, the expected restriction fragments for SUDO (242 bp and 115 bp) and BOTA (190 bp, 114 bp and 53 bp) were confirmed. However, BOTA presented an addition- al nonspecific fragment (304 bp). No Alu I restriction site TABLE II Restriction profiles of the species of interest using the mtDNA 358 bp fragment Host species Restriction enzymes (cleavage sites) Aci I CC↓GC Alu I AG↓CT Hae III GG↓CC Rsa I GT↓AC Homo sapiens (HOSA) Sequenced NCBI (AY509658) 189; 113; 55 188; 114; 55 358 358 233; 124 232; 125 358 358 Rattus novergicus (RANO) Sequenced NCBI (AB033713) 358 358 358 358 358 358 267; 59; 31 267; 59; 31 Didelphos marsupialis (DIMA) Sequenced NCBI (DMU34665) 244; 113 244; 133 358 272; 69; 16 358 358 326; 31 326; 31 Canis familiaris (CAFA) Sequenced NCBI (DQ309764) 358 358 190; 167 190; 165 358 358 358 358 Felis catus (FECA) Sequenced NCBI (AY509646) 244; 113 243; 114 190; 120; 47 189; 120; 48 272; 74; 11 273; 73; 11 214; 119; 24 213; 144 Sus domesticus (SUDO) Sequenced NCBI (AY534296) 358 358 242; 115 242; 115 153; 130; 74 153; 130; 74 358 358 Bus taurus (BOTA) Sequenced NCBI (AY682380) 358 358 190; 114; 53 190; 169 159; 124; 74 159; 126; 74 322; 31; 4 322; 33; 4 Gallus gallus (GAGA) Sequenced NCBI (AY509649) 308; 49 309; 48 358 358 159; 124; 74 159; 125; 73 208; 149 209; 148 Equus caballus (EQCA) Sequenced NCBI (AY819736) 244; 113 358 160; 85; 59; 53 160; 84; 59; 54 159; 124; 74 159; 125; 73 358 358 Cerdocyon thous (CETH) Sequenced NCBI (AF028169)a 358 - 190; 167 - 358 - 358 - a: the prime BM1 did not recognise a sequence of cytochrome B gene; NCBI: National Center for Biotechnology Information. Fig. 2: polymerase chain reaction-restriction fragment length poly- morphism on the DNA samples of interest amplified using the BM1 and BM2 primers and digested using Aci I, Alu I, Hae III and Rsa I (fragment of mitochondrial cytb ≅ 358 bp). L: DNA Leader 50 bp; 1: Aci I; 2: Alu I; 3: Hae III; 4: Rsa I. Blood meal source of Lu. longipalpis • Vítor Yamashiro Rocha Soares et al.382 was found for DIMA, RANO, GAGA or HOSA. In addi- tion to the expected fragments for EQCA and FECA, un- expected fragments were also observed: 242 bp and 115 bp for EQCA and 237 bp for FECA. CETH and CAFA presented bands of 190 and 167 bp, as expected (Fig. 2, Table II). As reported by other authors, nonspecific bands were also visualised in the present study (Zhang & Hewit 1996, Partis et al. 2000, Steuber et al. 2005). One explanation for this phenomenon could be the co- amplification of cytb pseudogenes. Pseudogenes are non- functional copies of mtDNA fragments present in nuclear DNA. However, when the expected fragments are also viewed, identification of the species is not impaired. Digestion with the Hae III endonuclease allowed differentiation between several species of vertebrates. GAGA and EQCA presented the same pattern of bands (159 bp, 124 bp and 74 bp); however, BOTA presented an extra fragment (290 bp). SUDO (130 bp, 153 bp and 74 bp) and HOSA (233 bp and 124 bp) showed the ex- pected patterns. No Hae III restriction site was found for CAFA, CETH, DIMA or RANO. FECA presented both nonspecific and expected bands (Fig. 2, Table II). Digestion with the Rsa I enzyme made it possible to differentiate CETH, RANO, GAGA and SUDO from the other host species. The restriction pattern for GAGA was as expected (208 bp and 149 bp). BOTA and DIMA presented single fragments of 322 bp and 326 bp, respec- tively. Fragments smaller than 31 bp were not visualised. Rsa I did not cut DNA extracted from HOSA, EQCA, SUDO, CETH or CAFA (Fig. 2, Table II). The enzymes Aci I, Alu I, Hae III and Rsa I were suf- ficient for the differentiation of the species of interest, with the exception of CAFA and CETH, which present- ed the same restriction profile. A fifth enzyme or other genetic marker could be used to differentiate these two species. This differentiation is of great epidemiological interest because foxes and dogs share an important role as reservoirs of visceral leishmaniasis. As foxes have periurban habitats, this identification method could con- firm whether foxes maintain the urban cycle (Costa & Vieira 2001, Silva et al. 2001). To verify whether PCR-RFLP of the cytb gene can be used to evaluate the blood meal source of sandflies, a total of 80 female specimens of Lu. longipalpis were caught in domestic and peridomestic environments us- ing two electrically powered CDC light traps. DNA was extracted from the intestinal contents of sandflies and PCR amplification was performed using BM1 and BM2 primers. The 358 bp fragment of cytb was identified in 76 samples. Most of the sandflies had blood in their digestive tubes. Initially, this finding enabled analysis by means of sequencing or PCR-RFLP. Of the 76 samples, 10 were chosen randomly and their PCR products were individu- ally digested using four restriction enzymes (Aci I, Alu I, Hae III and Rsa I). In four out of the 10 sandflies, the food sources were assumed (Fig. 3, Table III). The food sources of samples 1 and 2 were believed to be EQCA. The probable food sources of samples 3 and 4 were HOSA and BOTA, respectively. Some fragments could not be identified because of their size or due to the small amount of DNA present. It is possible that the low quantity DNA resulted in weak or even missing band signals, making it difficult to analyse the fragment profile. Theoretically, this technique could become less accurate if DNA was degraded via intestinal digestion (Mukabana et al. 2002a). A detailed analysis of sandflies in the laboratory, using a known food source and performing measurements at spe- cific time points, could resolve this issue. Therefore, the PCR-RFLP technique has the potential to be useful for phlebotomine blood meal source identifi- cation. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge of intraspecific mtDNA variations. TABLE III Probable restriction profiles of the sandflies using the mtDNA 358 bp fragment Sandflies Restriction enzymes (cleavage sites) Aci I CC↓GC Alu I AG↓CT Hae III GG↓CC Rsa I GT↓AC Sample 1 244; 180; 133; 55 242; 159; 113; 55 159; 124 358 Sample 2 244; 180; 133; 55 242; 159; 113; 55 159; 124 358 Sample 3 189; 113 358 233; 124 358 Sample 4 358 190; 114 290; 159; 124; 74 322 Fig. 3: polymerase chain reaction-restriction fragment length poly- morphism on the DNA samples from sandflies amplified using the BM1 and BM2 primers and digested using Aci I, Alu I, Hae III and Rsa I (fragment of mitochondrial cytb ≅ 358 bp). L: DNA Leader 50 bp; 1: Aci I; 2: Alu I; 3: Hae III; 4: Rsa I. 383Mem Inst Oswaldo Cruz, Rio de Janeiro, Vol. 109(3), May 2014 REFERENCES Boakye DA, Tang J, Truc P, Merriweather A, Unnasch TR 1999. Iden- tification of blood meals in heamatophagous Diptera by cyto- chrome B heteroduplex analysis. Med Vet Entomol 13: 282-287. Chow-Shaffer E, Sina B, Hawley WA, de Benedicts J, Scott TW 2000. Laboratory and field evaluation of polymerase chain reaction- based forensic DNA profiling for use in identification of human blood meal sources of Aedes aegypti (Diptera: Culicidae). J Med Entomol 37: 492-502. Costa CHN, Courtenay O 2003. A new record of the hoary fox Pseu- dalopex vetulus in North Brazil. Mammalia 67: 593-594. Costa CHN, Vieira JBF 2001. Mudanças no controle da leishmaniose visceral no Brasil. Rev Soc Bras Med Trop 34: 223-228. Dias FOP, Lorosa ES, Rebêlo JMM 2003. Fonte alimentar sanguínea e a peridomiciliação de Lutzomyia longipalpis (Lutz & Neiva, 1912) (Psychodidae, Phlebotominae). Cad Saude Publica 19: 1373-1380. Garlapati RB, Abbasi I, Warburg A, Poché D, Poché R 2012. Iden- tification of blood meals in wild caught blood fed Phlebotomus argentipes (Diptera: Psychodidae) using cytochrome B PCR and reverse line blotting in Bihar, India. J Med Entomol 49: 515-521. Lee JH, Hassan H, Hill G, Cupp EW, Higazi TB, Mitchell CJ, Godsey MS, Unnasch TR 2002. Identification of mosquito avian-derived blood meals by polymerase chain reaction-heteroduplex analysis. Am J Trop Med Hyg 66: 599-604. Marassá AM, Consales CA, Galati EAB, Nunes VLB 2006. Identifi- cação do sangue ingerido por Lutzomyia (Lutzomyia) longipalpis (Lutz & Neiva, 1912) e Lutzomyia (Lutzomyia) almerioi (Galati & Nunes, 1999) pela técnica imunoenzimática do ELISA de captura no sistema avidina-biotina. Rev Soc Bras Med Trop 39: 183-186. Meece JK, Reynolds CE, Stockwell PJ, Jenson TA, Christensen JE, Reed KD 2005. Identification of mosquito blood meal source by terminal restriction fragment length polymorphism profile anal- ysis of the cytochrome B gene. J Med Entomol 42: 657-667. Mukabana WR, Takken W, Killeen GF, Hawley WA, Knols BGJ 2002a. Extent of digestion affects success of amplifying human DNA from blood meals of Anopheles gambiae (Diptera: Culici- dae). Bull Entomol Res 92: 233-239. Mukabana WR, Takken W, Knols BGJ 2002b. Analysis of arthropod blood meals using molecular genetic markers. Trends Parasitol 18: 505-509. Muturi CN, Ouma JO, Malele II, Ngure RM, Rutto JJ, Mithöfer KM, Enyaru J, Masiga DK 2011. Tracking the feeding patterns of tse- tse flies (Glossina Genus) by analysis of blood meals using mito- chondrial cytochromes genes. PLoS ONE 6: e17284. Partis L, Croan D, Guo Z, Clark R, Coldham T, Murby J 2000. Evalu- ation of a DNA fingerprinting method for determining the spe- cies origin of meats. Meat Scie 54: 369-376. Pettersson E, Bensch S, Ander M, Chirico J, Sigvald R, Ignell R 2013. Molecular identification of blood meals and species composition in Culicoides biting midges. Med Vet Entomol 27: 104-112. Ribeiro JMC 1999. Vector biology. In RL Guerrant, DH Walker, PF Weller (eds.), Tropical infectious diseases: principles, pathogens and practice, Churchill Livingstone, Philadelphia, p. 124-133. Silva VC, Gomes RBB, Barral A, Costa CHN 2001. ELISA não dife- rencia sangue de cão doméstico de sangue de raposa. Rev Soc Bras Med Trop 34: 757. Steuber S, Abdel-Rady A, Clausen PH 2005. PCR-RFLP analysis: a promising technique for host species identification of blood meals from tsetse flies. Parasitol Res 97: 247-254. Tiwananthagorn S, Bhutto AM, Baloch JH, Soomro FR, Kawamura Y, Nakao R, Aoshima K, Nonaka N, Oku Y, Katakura K 2012. Zoophilic feeding behaviour of phlebotomine sand flies in the endemic areas of cutaneous leishmaniasis of Sindh province, Pakistan. Parasitol Res 111: 125-133. Zhang DX, Hewit GM 1996. Nuclear integrations: challenges for mi- tochondrial DNA markers. Trends Ecol Evol 11: 247-251. 1Supplementary data Blood meal source of Lu. longipalpis • Vítor Yamashiro Rocha Soares et al. Comparison of the restriction sites between the cytb fragment deposited in GenBank and the sequenced fragment from Didelphis marsupialis.